Download presentation
Presentation is loading. Please wait.
Published byΖεβεδαῖος Αργυριάδης Modified over 5 years ago
1
MapView: visualization of short reads alignment on a desktop computer
InCoB 2009 MapView: visualization of short reads alignment on a desktop computer Hua Bao Sun Yat-sen University
2
Next-generation sequencing
Sequencing by synthesis High-throughput (tens of millions reads per lane) Read length is short (25-50bp) Sequencing error rate is relatively higher than Sanger sequencing
3
Statement of the problem
1. Alignment results: (e.g. , 50M reads) read1 TATCGCACATAGTTCGCG hhhhhhhllhhhh;hA Chr read2 CATACGACACTCATGTAG h,abhhhh;hAhhda, Chr2 94 2. Reference genome: (e.g. , 500M bp) >Chr1 CGATCGAGCGACAGACGAGCACACGTAGCACTGTGGGGGAA Visualization of large-scale alignment data with super-high computational efficiency.
4
Computational efficiency
Memory usage : Data compressed Fractional loading CPU time : Indexing Pre-computing
5
File format design MapView format (MVF) : Head Data Index Statistics
Basic info of reference and reads Offset of Data, Index and Statistics Compressed sequences Ordered alignments The offset address of data is indexed by reference position Coverage information of reference site Head Data Index Statistics
6
Loading algorithms MapView file Jump to different region MapView
window MapView window Genomic position Using Index Offset address Data Data MapView file
7
Efficiency of MapView Computational efficiency comparision Tool
Version Memory usage CPU times Consed 18.0 12.06 GB 208 s Hawkeye 2.0.8 14.14 GB 296 s EagleView 2.2 3.91 GB 207 s MapView 3.1 0.04 GB 2 s The alignment data for the assessment are of reference length 43 million bp and 6 million Illumina 44-bp reads.
8
User-friendly Interface
9
User-friendly Interface
10
User-friendly Interface
11
Summary Super-high computational efficiency:
Visualization of hundreds of millions reads with 40M memory in 2 seconds. Rich featured and user-friendly: Compact alignment view for both single-end and paired-end short reads, multiple navigation and zoom modes.
12
Thank you! MapView: visualization of short reads alignment
on a desktop computer Thank you!
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.