1. CHU Ulg Liège, Centre for Human Genetics
Acquired alterations of IG and TCR loci in lymphoproliferative disorders
Sabine Franke, PhD
CHU Ulg Liège, Centre for Human Genetics
Interuniversity course 2017/18 - HUMAN GENETCIS
20. April ULG

2. Overview What are lymphoproliferative disorders?
What are ‘IG’ and ‘TCR’?
What are IG/TCR alterations?
How to detect IG/TCR alterations?

3. Overview What are lymphoproliferative disorders?
What are ‘IG’ and ‘TCR’?
What are IG/TCR alterations?
How to detect IG/TCR alterations?

4. Blood cell development
major types
of lymphocytes

5. Three major types of lymphocytes
B cells
T cells
Natural killer (NK) cells
Origin lymphoproliferative disorders

6. Function of B and T cells
B cells are primary responsible for humoral immunity (relating to antibodies)
T cells are involved in cell-mediated immunity.
B cells play a large role in the adaptive immune system by making antibodies to identify and neutralize bacteria and viruses.
Protection of the body by …

7. B-cells Millions of different types of B cells each day
In the blood and lymphatic system role of immune surveillance
No production of antibodies until fully activated
The human body makes millions of different types of B cells each day.
They circulate in the blood and lymphatic system performing the role of immune surveillance.
B-cell circulate in the blood and lymph but are not producing antibodies. They need a signal to differenciate further
They do not produce antibodies until they become fully activated.

8. 1) Combinatorial diversity (Somatic recombination) 2) Junctional diversity (Inaccurate junction) 3) Somatic hypermutation (Affinity maturing in germinal centres)
B cells are produced in the bone marrow. B cell development occurs through several stages
Three B-cell-specific DNA remodelling mechanisms that modify immunoglobulin (Ig) genes are involved at different stages of B-cell development135: VDJ recombination, somatic hypermutation and Ig heavy chain (IgH) switch recombination. Sequential and regulated VDJ recombination assembles combinations of the many Ig V, D and J segments in precursor bone-marrow B cells to create Ig heavy chain (H)/Ig light chain (L) antigen receptors. A D segment combines with a J segment and then a V segment combines with this DJ segment to form a unique IgH VDJ sequence in pro-B cells; then, V and J segments combine to form a unique IgL VJ sequence in pre-B cells; additional joining of V and J segments occurs as part of receptor editing in self-reactive immature B cells. Immature B cells that express functional surface IgM exit the bone marrow and home to secondary lymphoid tissues as mature B cells.
Productive interaction of mature B cells with antigen results in proliferation and differentiation. The primary immune response generates pre-germinal-centre plasma cells that typically are short lived, and usually secrete IgM but can secrete other Ig isotypes as a result of IgH switch recombination116, 117, 136. Germinal centres are generated during the primary immune response. Antigen-activated lymphoblasts that enter a germinal centre are subjected to multiple rounds of somatic hypermutation of IgH and IgL V(D)J sequences and antigen selection. Cells that express high-affinity antigen receptors are selected for survival, with subsequent differentiation to memory B cells or post-germinal-centre plasma cells. Post-germinal-centre plasmablasts/plasma cells (including those generated from memory B cells) that undergo IgH switch recombination typically home to the bone marrow, where they reside as terminally differentiated, non-proliferating, long-lived plasma cells for >30 days but sometimes years.
Nearly 80% of B-cell tumours arise from germinal-centre or post-germinal-centre B cells120, indicating that the intrinsic genetic instability of B cells that is unleashed in the germinal centre is important for their development. Although somatic hypermutation can cause mutations in some non-Ig genes137, 138, it is unclear if the germinal-centre environment is responsible for any oncogenetic changes other than primary Ig translocations. Multiple myeloma cells are the transformed counterparts of post-germinal-centre bone-marrow plasmablasts/plasma cells (reviewed in Refs 66,139).
B cells: plasma B cells and memory B cells. The B cell may either become one of these cell types directly or undergo an intermediate differentiation step, the germinal center reaction, where the B cell will hypermutate the variable region of its immunoglobulin gene ("somatic hypermutation") and possibly undergo class switching.

9. of the antigen receptor genes occur during the lymphoid proliferation
Gene rearrangements
of the antigen receptor
genes occur during the
lymphoid proliferation
Gene rearrangements
of the antigen receptor
genes occur during the
lymphoid proliferation
In detail later

10. Lymphoproliferative disorders (LPDs) LPDs refer to several conditions in which lymphocytes are produced in excessive quantities.
Chronic lymphocytic leukemia (most frequent) 25%
Acute lymphoblastic leukemia
Hairy cell leukemia
lymphomas
Multiple myeloma
Waldenstrom’s macroglobulinemia
Wiskott-Aldrich syndrome
Post-transplant lymphoproliferative disorder
Autoimmune lymphoproliferative syndrome (ALPS)
‘Lymphoid interstitial pneumonia’
The most frequent disorders in which lymphocytes are produced in excessive quantities.
Here is one kind of cell excessive present. These are the malignancies of the lymphsystem.
CLL most frequent in adults

11. B, T, and NK lineage of lymphoid malignancies
Lymphoid malignancy B lineage T lineage NK lineage
Acute lymphoblastic leukemia – children – 86% – 18% < 1% – adults – 80% – 25% < 1%
Chronic lymphocytic leukemias 95 – 97% – 5% – 2%
Non-Hodgkin lymphomas – nodal NHL – 97% – 5% < 2% – extranodal NHL – 95% – 10% < 2% – cutaneous NHL – 40% – 70% < 2%
Multiple myeloma 100% 0% 0%
B, T, and NK lineage of lymphoid malignancies

12. 1.Take home message Three major types of lymphocytes
In LPDs lymphocytes are produced in excessive quantities
Different lymphoid malignancies of different lineage origin

13. Overview What are lymphoproliferative disorders?
What are ‘IG’ and ‘TCR’?
What are IG/TCR alterations?
How to detect IG/TCR alterations?

14. Image source: Immunobiology, 5th edition Janeway et al
B-cell and T-cell receptors
Each B cell has a unique receptor protein (referred to as the B cell receptor (BCR)) on its surface that will bind to one particular antigen.
Image source: Immunobiology, 5th edition Janeway et al

15. Structure of the B-cell receptors
The antibody is composed of two light (L) and two heavy (H) chains
The BCR is a membrane-bound immunoglobulin, and allows the distinction of B cells from other types of lymphocytes and is the main protein involved in B cell activation.

16. The ability to produce billions of different antibodies in
humans results from the production of variable regions
of light and heavy antibody genes by DNA rearrangement.
Heavy chain (IGH)
Light chain (IGL)
The five major classes of heavy chain are IgM, IgG, IgA, IgD, and IgE.
Every chain has a variable and a constant domain.
The variable domains develop the antigen

17. Schematic representation of an Immunoglobulin (IG)
In the H chain loci there are 3 regions V,D,J which combine ramdomly to produce a unique variable domain in the IgH of each individual B cell.
Similar rearrangements occur for L chain locus V,J

18. Image source: Immunobiology, 5th edition Janeway et al
Structur of the T-cell receptor
Image source: Immunobiology, 5th edition Janeway et al

19. T-cell receptor gene rearrangement
The variable domain of both the TCR α-chain and β-chain
have three hypervariable or complementary determining regions (CDRs)
Receptor for antigen on the majority
of mature T-cells consists of two
polypeptides alpha and beta that are
linked by disulphide bonds and are associated with CD3
A small population of mature T-cells
express a different TCR heterodimer
in association with CD3. This is
composed of two polypeptides
designated gamma and delta

20. 2. Take home message
Structure of the B and T cell receptor is important
Ig and TCR consists of a variable and a constant region
Ig consists of heavy and light chains

21. Overview What are lymphoproliferative disorders?
What are ‘IG’ and ‘TCR’?
What are IG/TCR alterations?
How to detect IG/TCR alterations?

23. The production of variable regions of light and heavy antibody genes by DNA rearrangement.
Process of Ig formation at the different stages of B cell development
H chain D-J V-DJ H chain is rearranged
VJ VJ chain L rearranged When B cells fails in any step, it will die =apoptosis
Only portion of cells survive to participate in the long-lived peripheral B cll pool

24. The production of variable regions of heavy antibody genes by DNA rearrangement.
stepwise rearrangement of V, D, and J gene segments
Genes encoding antigen receptors are unique:
high diversity
developing
lymphocytes through
V(D)J rearrangement.

25. These V-J gene rearrangements generate
products that are unique in length and sequence
in each cell resulting in diverse antigen
expressing B cells.

26. B cell development

27. Cell development. Stage Heavy chain Light chain
Progenitor (or pre-pro) B cells
germline
Early Pro (or pre-pre)-B cells
undergoes D-J rearrangement
Late Pro (or pre-pre)-B cells
undergoes V-DJ rearrangement
Large Pre-B-cells
is VDJ rearranged
Small Pre-B cells
undergoes V-J rearrangement
Immature B cells
VJ rearranged
Mature B cells

28. T cell rearrangement

29. Estimated diversity of human Ig and TCR molecules
IgH Igα Igג TCR α β γ δ
molecules molecules
Number gene segments
V gene segments ~ ~ ~ ~46 ~47 ~6 ~6
D gene segments
J gene segments
Combination diversity >2x x <5000
Junctional diversity
Total diversity > > >10 12

30. Possible variation through recombining gene fragments?
Over 15,000,000 combinations of variable, diversity and joining gene segments are possible.
Imprecise recombination and mutation increase the variability into billions of possible combinations.
So how much variation is possible through recombining gene fragments?

31. 3. Take home message Gene rearrangements of the antigen receptor
genes occur during the lymphoid proliferation
B-cells: Stepwise rearrangement of V, D, and J gene
segments
Unique products of V(D)J rearrangements resulting in diverse antigen expressing B-cells

32. Overview What are lymphoproliferative disorders?
What are ‘IG’ and ‘TCR’?
What are IG/TCR alterations?
How to detect IG/TCR alterations?

33. Clinically relevant testing
B-cell versus T-cell malignancy (origine)
Reactive versus malignant
New lymphoma versus recurrence
Assessment of remission and relapse
Bone marrow involvement
Evaluation of treatment effectiveness

34. Analysis Techniques Detecting gene rearrangements
of the antigen receptor genes
Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products

35. PCR Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products
GeneScanning analysis
Fast, accurate, sensitive
non-quantitative monitoring of clonal proliferations
Need sequence equipment
Heteroduplex analysis
Sensitivity ~5-10%
available to most laboratories

36. Ig genes: IGH: VH-JH and DH-JH
Design of novel primer sets for detection of Ig/TCR rearrangements
BIOMED-2 study (multiplex PCR)
Ig genes: IGH: VH-JH and DH-JH
IGK: V-J and Kde rearrangements
IGL: V-J
TCR genes: TCRB: V-J and D-J
TCRG: V-J
TCRD: V-J, D-D, D-J, and V-D

37. BIOMED-2 clonality strategy
Suspected
B-cell lymphoma
Suspected lymphoma
of unknown origin
Suspected
T-cell lymphoma
TCRGVJ (A and B)
TCRB V(D)J (A and B)
TCRB DJ
IGH V(D)J FR1, FR2, FR3
IGH DJ(A)
IGK-VJ and DE

38. CTGTGCAAGAG Van Dongen et al Leucemia 2003
Lymphocyte population derived from one single cell.
CTGTGCAAGAG
CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG
………..
Van Dongen et al Leucemia 2003

39. U. Hershberg et E.T. Luning Prak 2015

40. Van Dongen et al Leucemia 2003
CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG
FRI FRII FRIII

41. Van Dongen et al Leucemia 2003

42. PCR GeneScan analysis
region

43. Example BIOMED-2 multiplex IGH VH-FR2–JH
Use of controls

44. Analysis of TCRB gene rearrangements

45. Analysis of TCRB gene rearrangements

46. From the patient to the analysis
Selection of material
Protocol
Check DNA quality
Clonality analysis

47. Examples of cases Case 1: Lymphoma? Reactive? Case 2: Relapse?
Case 3: T-cell lymphoma

48. Case 1 Female 63 years Lymphoma in dec. 2004
FR1 polyclonal, FR3 monoclonal
Feb biopsy
Relapse?

49. Case 1: GeneScan analysis of controls
H2O

50. Case 1: Relapse?
FR3
12/2004
2/2009
Biopsie
FR3: 152 bp
2000
600

51. Case 1: Results Controls ok B-cell targets: IGH(VDJ) FR3 clonal
Conclusion of the molecular results:
Clonal rearrangement of the IGH gene
was detected in this specimen.
This gene rearrangement profile is identical to the
one detected in the biopsie of 12/2004 and
confirms the relapse of the disease.

52. Case 2
Female
81 years
Biopsie
Lymphoma?

53. Case 2
3/2009
biopsie
FR1
327,11 bp
2700
control
100

54. Case 2: Results Controls ok B-cell targets: IGH(VDJ) FR1 monoclonal
Conclusion of the molecular results:
Clonal rearrangements of the IGH gene
were detected in this specimen.
This gene rearrangement profile fits to the presense of a
monoclonal B-cell population/B-NHL.

55. Case 3: Male 75 years Lymphoma origine? 2 biopsies First results:
FR1, 2, 3 kappa polyclonal

56. Case 3: TCRG

57. Case 3: TCRG

58. Use of clonality analysis
1. Making the diagnosis
Normal  reactive  malignant
2. Assessment of remission and relapse
3. Involvement (staging)
4. Evaluation of treatment effectiveness
Detection of minimal residual disease (MRD)
MRD-based risk-group stratification (treatment reduction or treatment intensification)

59. 4. Take home message Gene rearrangements of the antigen receptor
genes occur during the lymphoid proliferation
These gene rearrangements generate products
that are unique in length and sequence in each cell.
In a clonal population (from one cell) all cells have the
identical gene rearrangement.
Unique length allows by PCR discrimination of
monoclonality and polyclonality
Standardized protocol