1. Title
Detection of HLA-B*58:01 with TaqMan assay and its association with allopurinol-induced sCADR.

2. outline Introduction Methods of study Results of the study Conclusion
Statistics for the sickness and treatment
Focus of the study
Methods of study
Sampling
Preparation of samples
Primer design
Optimized PCR reaction condition
figures
Results of the study
Identification of HLA-B*58:01 gene
Accuracy, specificity and sensitivity
Tables and figures
Conclusion

3. Introduction
The current methods of testing HLA-B*58:01have been determined as too laborious such that it is a challenge to use them in the routine clinical detection.
This article concentrates on developing new methods of detecting HLA- B*58:01 and TaqMan assay as well as investigating its association to allopurinol-induced sCADR.
It is estimated that 2% of men with 30 years and above and women with 50 years and above develop hyperuricemia and gout.

4. Methods of study
The method of the study include developing a combination of sequence- specific primers(SSP) together with TaqMan probe amplification in order to determine presence of HLA-B*58:01 in various groups.
The groups to be used for the study include : 28 healthy people, allopurinol-induced sCADR group of 48 and 133 people who are allopurinol-tolerant
The commonly used method of detecting HLA-B*58:01 is the screening method, which is inconvenient for use in most hospitals.

5. Preparing samples The samples of the three groups were collected.
The concentration of the DNA was tested and evaluated to be 20 to 200 ng/μL.
The OD, on the other hand, was 1.65 to 1.85.
The temperatures of the DNA samples were maintained at a temperature of 80 °C.
The genomic DNA were extracted from EDTA-ant-coagulated blood samples through DNA blood Mini Kit. During samples preparation, each step has to be keenly followed to obtain perfect results.

6. Primer design
To genotype patients for the HLA-B*58:01, polymerase chain reactions was carried out by use of SSPs.
A mismatch was later inserted to the second and third base for facilitation of HLA-B alleles.
To determine quality of the DNA samples, a β-globin gene was employed as the quality control.
A pair of primers was used in combination with two TaqMan probes where specific primers used to amplify portions of exon 2 and 3.

7. .
The quality control was estimated to contain 2 × KAPA® PROBE FAST qPCR Master Mix and other elements that led to an overall of 20 hydrated μL volume.
In the reactions, as well, the performed TaqMan real-time PCR had ABI PCR systems that were real-time.
The temperature conditions were regulated after every 3 min and the resultant fluorescence were determined after every cycle.
Quality control is relevant in the method and it helped to obtain regulated results. Maintaining temperature conditions after every 3min helped to obtaone varying fluorescence for experiment.

8. The sequence-specific primers together with TaqMan probe locations can be illustrated as shown in the figure below.

9. Specific Primers as well as TaqMan probes for HLA-B
Specific Primers as well as TaqMan probes for HLA-B*58:01 allele can be illustrated as shown in the table below.
Sequence (5’-3’)
Primer
5801-F
GGGCCGGAGTATTGGGATG
5801-R
GCCATACATCCTCTGGATGA
β-Globin-F
AGTCAGGGCAGAGCCATCTA
β-Globin-R
TTAGGGTTGCCCATAACAGC
TaqMan probe
5810-probe1
JOE-ACCGAGAGAACCTGCGGATCGCGCTCC-BHQ2
5810-probe2
CY5-TCCGAGATCCGCCTCCCTGAGGCC-BHQ2
β-Globin-probe
FAM-AGTCTGCCGTTACTGCCCTGTGG-TAMRA

10. Results of the study
The new method employed was successful identifying HLA-B*58:01in many alleles of HLA-B.
The results obtained in the 344 DNA samples were determined to be concordant with the results obtained in commercial PCR-SSP HLA-B Kit.
Finally, the results showed that samples which generated JOE and CY5 had HLAB*58:01 allele while those that had no signal of HLAB*58:01 allele had a successful amplification of a single probe type.
The results obtained revealed that the method used to test HLA-B*58:01 was successful. The method can therefore be used to supplement the screening method which is incomvenient in most hospitals.

11. Accuracy, specificity and sensitivity
89 DNA samples from the various groups simultaneously generated JOE and CY5 amplification curves during the HLA-B gene reaction as well as a β-globin gene reaction which indicated that the samples had HLA-B*58:01 allele (Zhang, 2015 pg. 386).
The rest of the 225 DNA samples that did not generate fluorescence amplification indicated that the HLA-B*58:01 was negative.
The accuracy of the study can be determined by the simultaneous amplification of curves which revealed that each of the sample was accurately studied. The results obtained, therefore, were valid.

12. The results of HLA-B*58:01 allele frequency in sCADR, control groups and allopurinol-tolerant can be illustrated in a table as follows: (Zhang,2015 pg. 388)
HLA-B*58:01
OR (95% CI)
Allopurinol-induced sCADR
93.8% (45/48)
<
108.5(33.7–346.3)
Allopurinol-tolerant
7.5% (10/133)
0.1547
0.6 (0.3–1.2)
General population control
12.1% (34/280) _
From the table, it can be concluded that Allopurinol-induced sCADR have the highest frequency of the allele while the general population control has the lowest.

13. The figure below shows the limit of detecting TaqMan assay through the serially testing of HLA-B*58:01 DNA (Zhang,2015 pg. 387).

14. Conclusion
From the above study, the development of an assay consisting combinations of SSPs and TaqMan probes in order to find out the presence of HLA- B*58:01 through a single reaction was successful.
By investigating the distribution of HLA-B*58:01, and allopurinol-induced sCADR and HLA-B*58:01, the data obtained indicated that it is possible to use HLA-B*58:01as a risk prediction maker before prescribing allopurinol (Zhang,2015 pg. 384).

15. References
Zhang, X., Ma, H., Hu, C., Yu, B., Ma, W., Wu, Z., Luo, X., Zou, H. and Guan, M., Detection of HLA-B* 58: 01 with TaqMan assay and its association with allopurinol-induced sCADR. Clinical Chemistry and Laboratory Medicine (CCLM), 53(3), pp
Kang, X., Chen, R., Han, M., Liu, Z., Liu, J., Dai, P., Chen, C. and Wang, H., Rapid and reliable genotyping of HLA-B* 58: 01 in four Chinese populations using a single-tube duplex real-time PCR assay. Pharmacogenomics, 17(1), pp