1. Mystery of the
Matching Marks

4. DO I HAVE YOUR ATTENTION?
For some reason, a GUNSHOT seems to suggest a CRIME SCENE…
with BULLETS…
and BULLET MARKS…

5. How are these marks used to solve crimes?

6. RIGHT! They are used to COMPARE
bullets found at a crime scene, with bullets that were fired from suspect guns

7. Here are the marks from a crime scene bullet…

8. and here are the marks from bullets fired from four possible suspect guns…

9. Which bullet matches the crime scene bullet?

10. Which bullet matches the crime scene bullet?

11. Which bullet matches the crime scene bullet?

12. Which bullet matches the crime scene bullet?D

13. RIGHT! It’s a bullet shot from gun C. So what does that tell us?
Crime Scene: C

14. YOU’VE GOT IT! The Crime Scene bullet and bullet C came from the SAME GUN !
We could say the bullets had a “Common Origin”

15. Many studies have told us that when any two items with COMPLEX PATTERNS MATCH EACH OTHER perfectly, we can be confident that they had a…
COMMON ORIGIN !

16. They had a… “COMMON ORIGIN”
KEEP THIS IN MIND: When we find other COMPLEX PATTERNS that MATCH, What does this tell us?
They had a…
“COMMON ORIGIN”
This is our theme: Matching Complex Patterns = COMMON ORIGIN

17. What is this?

18. Right, it’s a HUMAN KARYOTYPE

19. A Human Karyotype has photos of all the matched pairs of human chromosomes from one cell, stained to show banding patterns, and arranged from long to short, with centromeres near the top. Here are our numbers 6-9…

20. On the next slide, you will see another kind of human karyotype: It has diagrams of the chromosomes, with only one member of each pair, clearly showing their banding patterns…

22. And on the next slide, you will see a similar diagrammatic karyotype, but this is from a NON-HUMAN SPECIES…

24. As you COMPARE the CHROMOSOMES, side-by-side, what is MOST surprising?
NEXT, we wll see both karyotypes together, showing the matching chromosomes side by side:
each human chromosome
is on the left…
each NON-human chromosome
is on the right
As you COMPARE the CHROMOSOMES, side-by-side, what is MOST surprising?

25. What is most surprising?

26. Did you notice how very SIMILAR they are
Did you notice how very SIMILAR they are? Here’s a closer look at the first seven:
Any identical ones? What did we say about items with IDENTICAL COMPLEX PATTERNS?

27. RIGHT! Identical Patterns = COMMON ORIGIN
How would this apply to two different SPECIES with IDENTICAL banding patterns on their CHROMOSOMES?
RIGHT! They MUST have a Common Origin, or a COMMON ANCESTOR !

28. Time for a Revelation…
The non-human species is the CHIMPANZEE
The clear chromosome evidence of identical banding patterns tells us that humans and chimpanzees must have had a…

29. COMMON ANCESTOR !
Somewhere, in our distant past, there was an ape-like species that gave rise to two lines of ancestry. One branch led to modern CHIMPS, the other branch led to HUMANS.
Chimps Us
NOW
6 mya
<---Common Ancestor
DNA analysis and fossils tell us that this split was around 6-7 million years ago (6-7 mya)

30. That’s pretty strong stuff...
And seems to conflict with Traditional Views!
Is there any other evidence that supports this conclusion?
Let’s take another look at those chromosomes… [next set of slides]

31. Mystery of the
Matching Marks
part 2

32. Let’s look at our two sets of chromosomes again, side-by-side.
This time, Focus on their DIFFERENCES:
What do you see in the
chimp chromosomes (on the right) that is DIFFERENT from
the human chromosomes (on the left)?

33. How are they different?

34. What could have happened to cause those differences?
GOOD EYES! - Chimp’s #2 is shorter than our #2 -Chimp has an extra unmatched chromosome
What could have happened to cause those differences?
Let’s take a closer look
at those chromosomes…

35. “Missing” part
“Extra” in chimps
ANY IDEAS that
might EXPLAIN the “missing” part of the chimp’s #2 chromosome, AND the chimp’s “extra” chromosome?

36. Maybe the chimp’s “extra” chromosome was once part of its short #2.
Could the “extra” chromosome match the upper part of our #2?
LET’S TRY IT…

37. Let’s try it… Turn the “extra” one upside down?!
Nope! They don’t seem to match. What else could we try?
Turn the “extra” one upside down?!
Let’s try it…

39. WOW ! IT WORKED! They DO MATCH!
NOW, the next question: “How could this happen?”
Was there ONE #2 in our common ancestor, that split to make TWO in chimps, OR
Were there TWO short chromosomes in our ancestor that
fused (joined) to make ONE in humans?

40. We DO have a PROBLEM:
“How did this difference happen?”
And, we have two hypotheses (possible explanations):
1. One split to make two, OR
2. Two fused (joined) to make one
Let’s try the second one (fusion). How can we TEST that hypothesis?

41. But, what kind of evidence can we look for?
We could look for evidence of fusion in the middle of our #2 chromosome…
But, what kind of evidence can we look for?
Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

42. CHROMOSOME PARTS
All Chromosomes have telomeres at both ends (like shoelace aglets!)
Head Telomere
Centromere
Tail Telomere
Telomeres have a special DNA sequence…
ttagggttagggttagggttagggttagggttaggg…
||||||||||||||||||||||||||||||||||||
aatcccaatcccaatcccaatcccaatcccaatccc…

43. Did you notice the repeated sequence: ttaggg?
Head Telomere
DNA Sequence for Telomeres:
ttagggttagggttaggg…
||||||||||||||||||
aatcccaatcccaatccc…
NOTICE:
Tandem Repeats in Telomeres:
ttagggttagggttaggg…
||||||||||||||||||
aatcccaatcccaatccc…
Centromere
Tail Telomere
“ttaggg” is repeated times in each Telomere

44. Here’s another view of a chromosome, showing the telomeres untwisted, and their typical DNA sequence
It also shows that the upper (shorter) arm above the centromere is called the “p-arm”, and the lower (longer) arm is called the “q-arm”

45. and its “extra” chromosome (right)
TELOMERE DNA CLOSE-UP
Here are ends of the upper telomeres of the chimp’s “short” chromosome (left)…
and its “extra” chromosome (right)
Short #2
“Extra”

46. They do NOT fit when one telomere is twisted 180o (right)
NOTICE!
When we turn the “extra” chromosome upside-down, and try to connect it to the “short” chromosome, it only FITS one way (left)…
They do NOT fit when one telomere is twisted 180o (right)

47. Reading the top strand only, see: T T A G G G C C C T A A
FURTHERMORE… When we lay the fusion area on its side, we can see more clearly how the DNA sequence changes at the fusion point.
Reading the top strand only, see: T T A G G G C C C T A A

48. …ttagggttagggttagggccctaaccctaaccctaa…
THAT’S WHAT YOU WILL BE LOOKING FOR When you are searching the DNA for the Fusion Point, you will be looking at only one strand of DNA (since the “lower” strand is the predictable complement of the “upper” strand). Look for something like this:
…ttagggttagggttagggccctaaccctaaccctaa…
Read this like lines of text in a book… Do you see where the multiple g’s (and no c’s) END, and multiple c’s (and no g’s) BEGIN?

49. On which line does the change happen?
What would this point be called? (where multiple g’s stop, and multiple c’s begin)
This would be the FUSION POINT Raise your hand when you see that point in this actual DNA strand below:
On which line does the change happen?

50. GOT THE PICTURE? Maybe this will show it more clearly:
THERE’S the FUSION POINT !
GOT THE PICTURE?

51. NOW… WHERE should we LOOK for the FUSION POINT?2a
YES! Right in the MIDDLE of our chromosome #2, where the two matching chimp chromosomes overlap ! 2b

52. (Can you figure out where the number “2q13” comes from?)
This would be BELOW the CENTROMERE, in the “q-arm” of the chromosome, in the region known as “2q13”, shown in red. 2a 2b
(Can you figure out where the number “2q13” comes from?)

53. 3 = sub-part 3 of that region
(OPTIONAL)
For “2q13”…
2 = chromosome #2
q = the q-arm
1 = region 1 of that arm
3 = sub-part 3 of that region 2a 2b

54. So, where can we see the DNA from this region of our #2 chromosome
to examine?
I have gone to an online DNA database and printed out the DNA in that region.
You could do this yourself, but, to save time, I’ve done that for you…

55. This is what a page looks like…
This 2q13 region
gives us 52 pages of DNA!
This is what a page looks like…
On this page, there
are 57 lines,
each line with 60 bases (letters), and that gives us… 3,420 bases per page!

56. If these 52 pages were attached end-to-end, they would stretch about 14 meters (16 yards) around your room! AND…
If ALL the DNA from our ENTIRE #2 chromosome was printed out like this, it would stretch about 16 km (10 miles)!

57. Each number on the left edge equals the
By the way…
Each number on the left edge equals the
number of the first base (letter) on that line.
And, a space has been inserted
after every 10th base (letter) to make counting easier.

58. You may notice
when you are
searching, that
the “ttaggg” pattern
is not perfect!
An occasional “c”
slips in here and there,
and you will see other
minor “glitches.”
WHY?
If you said
“MUTATIONS,”
you would be right.

59. You get to SEARCH those 52 pages!
NOW, it’s YOUR turn!
You get to SEARCH those 52 pages!
Are you ready???
Just kidding! Actually, you will form teams of 3-4, and each team gets the same 4 pages (from the “2q13” region)

60. One of those 4 pages should have the “Fusion Area”
Each person looks for that “Fusion Area” on a different page.
When one of you finds it, show your partners.
Discuss your discovery with your partners,
and answer the questions
on your “SEARCH” worksheet

61. PREDICTIONS: If hypothesis is true, we
RECAP
PROBLEM: How did our #2 chromosome come to look identical to two chromosomes in chimpanzees”
Chimp Us
HYPOTHESIS: our #2 chromosome was formed by the fusion of two chromosomes in an ancestor, after chimps branched off.
Fusion?
<--Common Ancestor
TEST: Look for fusion evidence in the form of telomere DNA in the middle of our #2chromosome
PREDICTIONS: If hypothesis is true, we
should find two telomeres there; If NOT true, should be NO telomeres there.

62. GO SEARCH for the Tell-Tale Telomeres !

63. Students get into teams now, and pick up team folder with 4 DNA pages per team, and 1 worksheet per student.
Go to MMM2 for followup slides, to show after teams find fusion points, or to show optional DNA models of telomeres.

64. Mystery of the
Matching Marks
(Part 3)

65. DNA Search Lab Followup
Welcome back from your
SEARCH FOR
THE TELL-TALE TELOMERE
Let’s see what it tells us…

66. RESULTS: Can you see the telomeres?
agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg
ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg
gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg
gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc
tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg
taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt
cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta
agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt
tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc
aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc
ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct
accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta
accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca
ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc
ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac
ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac
cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa
ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct
ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg
ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc
cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc
taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

67. RESULTS CLARIFIED: FUSION POINT ! Head Telomere of “extra” chrom. 2a
agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg
ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg
gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg
gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc
tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg
taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt
cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta
agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt
tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc
aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc
ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct
accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta
accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca
ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc
ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac
ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac
cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa
ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct
ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg
ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc
cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc
taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg
Head Telomere of “extra” chrom. 2a
Head Telomere of “short” chrom. 2b
FUSION POINT !

68. Did you know… you’ve got FOSSILS in YOU !
All of you have these fossils, in the #2 chromosome of every cell !
Telo. 2a
taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt
cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta
agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt
tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc
aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc
ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct
accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta
Fossils are the remains of ancient life, and these are the telomeres of two chromosomes from your ancient ancestor !
Telo. 2b
So, these telomeres are your very own MOLECULAR FOSSILS !

69. CONCLUSION PREDICTIONS: If our hypothesis was true, we
should find two telomeres there; If NOT true, should be NO telomeres there.
Did we find telomeres there?
YES! Therefore…
Our hypothesis was supported: Our #2 chromosome WAS formed from the FUSION of two chromosmes in an ancient ancestor after the chimpanzees branched off.

70. A Peek at the Chromosomes of Other Apes…
On the next slide, you will see the chromosome diagrams for humans, chimpanzees, gorillas, and orangutans, all the :”Great Apes” They are shown side by side for easy comparison…

71. The Chromosomes of Humans and Apes Compared
For each number, the chromosomes are arranged in this order (left to right): human, chimpanzee, gorilla, orangutan
What is most striking?

72. Or, in this case… COMMON ANCESTRY
RIGHT! They are ALL
Strikingly Similar!
And what do we know when we find identical or very similar patterns on different items?
RIGHT! They had to have a COMMON ORIGIN
Or, in this case… COMMON ANCESTRY

73. of Modern Primates would be LOCATED on the tree…
Based on these chromosome comparisons… Biologists have been able to draw a phylogenetic tree, showing how primates are related to each other.
The following slide shows the tree (called a “Primate Cladogram”). See if you can point to where the COMMON ANCESTORS
of Modern Primates would be LOCATED on the tree…

74. Chimps
Humans

75. Did you find ALL of the Common Ancestors?
Chimps
Humans
Did you find ALL of the Common Ancestors?

76. Did you notice… All the other apes had that “extra” chromosome, too?
This confirms that this is the more PRIMITIVE (original) CONDITION, so our SINGLE
#2 chromosome is the
DERIVED CONDITION
(the result of fusion)

77. MORE CONFIRMING EVIDENCE
When we compare primates by using other features, including DNA, different proteins, anatomy, physiology, and fossils, Biologists have developed similar Cladograms (Phylogenetic Trees), like these…

78. See how similar they are?
Based on Albumin Protein Analysis:
Based on DNA Hybridization Analysis
See how similar they are?

79. And here’s another one… PRIMATE CLADOGRAM Based on Genome Analysis
Humans
Bonobos
Chimpanzees
Gorillas
Orangutans
Gibbons
Old World
Monkeys
6 mya
8 mya
13 mya
18 mya
25-30 mya
Species
Today
Common Ancestor
Again, basically the same pattern

80. Humans and chimps are even closer than zebras are to horses!
When all the data point to essentially the same conclusions, this strengthens those conclusions.
Biologically, humans are very closely related to the apes. In fact, chimps are closer to US, than they are to gorillas!
Humans and chimps are even closer
than zebras are to horses!
Biologists have even recommended that humans and chimps be in the same genus!

81. This may be hard for many to accept… But we are very special apes, not just “ordinary animals.”
Because of our brain and our dexterity, humans have built amazing cultures and environments not equaled anywhere else in the animal kingdom.
Will we use our talents to protect and manage our environment, or will we get lazy and lose it all?

82. REALITY-CHECK QUESTIONS MORE DNA SEARCHES
LESSON WRAP-UP
REALITY-CHECK QUESTIONS
MORE DNA SEARCHES

83. Time for a REALITY CHECK Number your paper from 1-8 Based on the observed data… Which are true… which are false?
1. All chromosomes have telomeres at both ends.
2. All chromosomes have telomeres in their middles.
3. Identical complex patterns on different items means they had a common origin.
4. A hypothesis is a prediction.

84. REALITY CHECK cont. Which are true… which are false?
5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor.
6. Humans evolved from monkeys.
7. Humans evolved from chimpanzees.
8. Humans & chimpanzees evolved from a common ancestor.

85. DID YOU ENJOY THE SEARCH? Here are some more DNA searches
Go online to search a DNA database - See “Chromosome Fusion” for directions (get internet address from teacher)
Look for the “Lost Centromere” - Did you notice that the centromere in the “longer” (lower) chimp chromosome disappeared? Is there any DNA evidence for a centromere still THERE in our #2 chromosome?
Look for telomere DNA on the ends of different chromosomes, different organisms.

86. ADDENDUM FOLLOWS More Evidence: Synteny Telomere Tid-Bits
END OF LESSON
ADDENDUM FOLLOWS
More Evidence: Synteny
Telomere Tid-Bits

87. ADDENDUM More Evidence (Synteny) Telomere Tid-Bits
Key to “Reality Check”
Extensions: DNA Searching

88. Confirmation: More Evidence
When we compare ALL the DNA in our #2 chromosome with ALL the DNA in the two chimp chromosomes…*
we find that it is all the same DNA !
*(this is “synteny”)

89. However…
When we compare ALL the DNA in our #2 chromosome with DNA in Dog chromosomes…
we find that our #2 is a patchwork of DNA from 8 different Dog chromosomes!
(WHY?)

90. If you said “More time since we branched from our
WHY?
If you said “More time since we branched from our
COMMON ANCESTOR
with dogs,
SO, more time for
more chromosome
changes and other
mutations,”
YOU GOT IT!

91. Telomere Tid-Bits
1. Telomeres apparently protect the ends of our chromosomes, keeping the gene-DNA from getting damaged.
2. Each time our chromosomes replicate and cells divide, a little of each telomere is lost, so they get shorter as we age!
3. This is one reason why embryonic stem cells are preferred over adult stem cells in stem cell research.

92. More Telomere Tid-Bits
4. There is an enzyme, telomerase, that can replace some of the missing telomere DNA. It’s thought that defective telomerase could be a cause of aging problems.
5. Telomeres and telomerase are the subjects of much research into cancer, heart disease, brain function, and other problems of aging.

93. KEY TO REALITY CHECK 1. All chromosomes have telomeres at both ends.
True
2. All chromosomes have telomeres in their middles.
False
3. Identical complex patterns on different items means they had a common origin.
4. A hypothesis is a prediction.

94. KEY TO REALITY CHECK (cont.)
5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor.
True
6. Humans evolved from monkeys.
False
7. Humans evolved from chimpanzees.
8. Humans & chimpanzees evolved from a common ancestor.
TRUE!

95. EXTENSIONS: DNA SEARCHING
1. For DNA in the 2q13 region online at NCBI, go to:
Scroll down about 1/3 scroll bar distance to ORIGIN of segment.
Then about 2/3 scroll bar down, to line for fusion area.
2. To explore ENTIRE chromosome #2, or to see DNA in other chromosomes or chromosomes of other animals, go to
Click on the species (Homo sapiens 36 for our chromosomes), then click on the desired chromosome number. Click area of chromosome (or blue line contig) where you want to see the DNA (2q13 in the human chromosome #2 for the fusion area).
For detailed directions, see “Chromosome Fusion” lesson:

96. EXTENSIONS: DNA SEARCHING
IDEAS for SEARCHING:
Take a look at the DNA in the tip ends (telomeres) of several chromosomes to see the characteristic tandem repeats of ...ttaggg...
2. Look for the missing centromere area in chromosome #2 where you should see remains of the centromere that was in the longer (lower) ancestral chromosome before it fused to the shorter chromosome. The missing centromere region should be in the 2q21.2 region.
3. Using the BLAST search tool, see if you can find fusion areas in other chromosomes.
Do similar searches on the ENSEMBL site at:
Click on a chromosome; look for Synteny in left column, etc.