1. Bruce Blumberg (blumberg@uci.edu)
BioSci D145 Lecture #7
Bruce Blumberg
4103 Nat Sci 2 - office hours Tu, Th 3:30-5:00 (or by appointment)
phone
TA – Riann Egusquiza
4351 Nat Sci 2– office hours M 1:45-3:45
Phone
check daily for announcements, etc
Updated lectures will be posted on web pages after lecture
Midterm key is posted. Please compare your answers with key before coming to discuss grading with me.
BioSci D145 lecture 1 page 1 ©copyright Bruce Blumberg All rights reserved

2. Term paper requirements and scoring
Actual paper – 5 pages single spaced 1” margins (references not included).
PLEASE DO NOT WRITE AN ABSTRACT
Specific aims – 2 points (this should be about 3/4 to one page)
Write a paragraph introducing the topic, state why it is important and what are the gaps in knowledge that you will address.
State a hypothesis to be tested
Enumerate 2-3 specific aims in the form of questions that test your hypothesis. Use 1-2 sentences to state how you will answer the question
Finish with a paragraph describing what is innovative about your work and what impact it will have. It is VERY IMPORTANT to state
the human health relevance of your research (if you are doing something biomedical) or
the broader impacts on advancing the frontiers of knowledge (for something that is not relevant to human health).
This is a critically important part of a grant application. You have to convince the reviewer that your work is important and worth funding.
BioSci D145 lecture 1 page 2 ©copyright Bruce Blumberg All rights reserved

3. Term paper requirements and scoring
Background and Significance – 3 points (about pages)
Briefly summarize what is known about the problem.
Not a comprehensive review, just a summary of the important points.
Succinctly state what is not known and why it is important that this research be done
Address knowledge gaps
Are you addressing something controversial?
talk about the controversy and why your work will address it directly.
In about one paragraph, state what is important about your proposed research and why will accomplishing it benefit the research community and world at large.
i.e., what is the potential impact if you are successful
Don’t repeat what was said in specific aims exactly but obviously they should be related.
BioSci D145 lecture 1 page 3 ©copyright Bruce Blumberg All rights reserved

4. Term paper requirements and scoring
Research plan – 4 points (about pages)
In a short paragraph, state what you will do and why it is important. (I know it seems repetitive by now, but reviewers are busy and will be skimming your grant. You need to hit them over the head a few times before they will get your point).
Restate each specific aim from the Specific aims section (one by one)
describe what you will do to address the aim
Break into subaims as appropriate
State the hypothesis to be tested in each
Explain the rationale
Describe briefly what approach you will take
Discuss what you expect to find
Point out any possible problems and alternative approaches
I am mostly concerned with your hypothesis and rationale here.
Not an all-encompassing proposal – 4-5 years by a small team (e.g., your PhD thesis research)
BioSci D145 lecture 1 page 4 ©copyright Bruce Blumberg All rights reserved

5. Chromatin immunoprecipitation - ChIP
ChIP is the only method for large-scale identification of direct transcriptional targets
General strategy
Crosslink proteins to nearby DNA with formaldehyde
Works for about 2 angstrom distances
What does this say about the specificity of the interaction?
Only specific interactions will be reflected in crosslinks
BioSci D145 lecture 7 page 5 ©copyright Bruce Blumberg All rights reserved

6. Chromatin immunoprecipitation - ChIP
ChIP - general strategy (contd)
Break chromatin into small chunks by sonicating
Typically want ~500 bp fragments
Evaluate sonication quality and extent by gel electrophoresis to ensure that size range is obtained
Needs MUCH optimization
BioSci D145 lecture 7 page 6 ©copyright Bruce Blumberg All rights reserved

7. Chromatin immunoprecipitation - ChIP
ChIP - general strategy (contd)
Precipitate chromatin with antibody against protein of interest
Bind antibody, then capture complex with protein G/protein A beads
Reverse crosslinks – and remove proteins with proteinase K digestion
Purify DNA away from proteins
Evaluate enrichment of individual candidate binding sites by PCR
BioSci D145 lecture 7 page 7 ©copyright Bruce Blumberg All rights reserved

8. Chromatin immunoprecipitation - ChIP
Flavors of ChIP commonly in use
Standard ChIP – one antibody, few targets analyzed
Most commonly used method
ChIP-chip – chromatin immunoprecipitation on chip
Recovered fragments are used to probe microarray of genomic DNA
Allows identification of novel binding sites
Requires good genomic microarrays
Whole genome requires MANY chips (at least 7 for human and mouse) = EXPENSIVE
may not be available for your target organism
Affymetrix, Agilent, Nimblegen are sources
BioSci D145 lecture 7 page 8 ©copyright Bruce Blumberg All rights reserved

9. Chromatin immunoprecipitation - ChIP
Flavors of ChIP commonly in use
ChIP-sequencing – chromatin immunoprecipitation sequencing
Massively parallel sequencing of recovered fragments
Unbiased method to identify transcription factor binding sites
Price now lower than ChIP-chip
BioSci D145 lecture 7 page 9 ©copyright Bruce Blumberg All rights reserved

10. Chromatin immunoprecipitation – other applications
Various methods of probing chromatin structure with ChIP, etc
Chromatin conformation capture and related methods – useful to study spatial organization of chromosomes (mostly looping) and how this influences gene expression
3C – chromatin conformation capture
Capture-C (most modern version)
4C – circularized chromosome conformation capture
5C – carbon-copy chromosome conformation capture
ChIP-loop
Hi-C (first truly genome wide 3C method)
ChIA-PET – chromatin interaction analysis by paired-end tag sequencing
Useful to detect de novo long-range chromatin interactions
BioSci D145 lecture 7 page 10 ©copyright Bruce Blumberg All rights reserved

11. Popular methods to evaluate chromatin structure
BiSci D145 lecture 6 page 11 ©copyright Bruce Blumberg All rights reserved

12. Chromatin immunoprecipitation – other applications
Various methods of probing chromatin structure with ChIP, etc
Chromatin conformation capture and related methods – useful to study spatial organization of chromosomes (mostly looping) and how this influences gene expression
3C – chromatin conformation capture (Capture-C)
4C – circularized chromosome conformation capture
5C – carbon-copy chromosome conformation capture
ChIP-loop
Hi-C (first truly genome wide 3C method)
BioSci D145 lecture 7 page 12 ©copyright Bruce Blumberg All rights reserved

13. Identifying regions of open (presumably active) chromatin
Probe open chromatin
DNAse I-seq, Mnase-seq more sequences (higher counts) at promoters
FAIRE-seq – formaldehyde- assisted isolation of regulatory elements
higher counts at non-promoters
ATAC-seq - Assay for Transposase-Accessible Chromatin with deep sequencing (most sensitive, least material needed)
BioSci D145 lecture 7 page 13 ©copyright Bruce Blumberg All rights reserved

14. Identifying regions of open (presumably active) chromatin
Probe open chromatin
DNAse I-seq, Mnase-seq more sequences (higher counts) at promoters
FAIRE-seq – formaldehyde- assisted isolation of regulatory elements
higher counts at non-promoters
ATAC-seq - Assay for Transposase-Accessible Chromatin with deep sequencing (most sensitive, least material needed)
BioSci D145 lecture 7 page 14 ©copyright Bruce Blumberg All rights reserved

15. Computer-based methods that may help to identify binding sites
Phylogenetic footprinting – What is it?
Powerful method to identify regulatory elements in DNA sequences
Central assumption is that protein coding sequences evolve much more slowly than DNA sequences (or DNA sequences evolve faster)
Due to selective pressure on protein function
Sequences conserved in related organisms likely to be functional
Species selection-
Must be sufficiently diverged that functional domains stand out
Sufficiently conserved to that they can be identified
A variety of algorithms exist – typical approach is to use multiple programs and look for what is found in common.
BioSci D145 lecture 7 page 16 ©copyright Bruce Blumberg All rights reserved

16. Comparative genomics (contd)
Phylogenetic footprinting comparison of zebrafish, mouse and xenopus caudal orthologs (cdx4, cdx4, Xcad3)
A number of putative conserved elements identified including
TTCATTTGAATGCAAATGTA
Absolutely conserved in all 3 promoters
Compare with database
Also found in human cdx4 – a good validation of the result
As more genomes are sequenced and compared, phylogenetic footprinting becomes a very powerful filter to identify potentially conserved regulatory sequences
ECR browser offers precomputed comparisons of conserved elements
ENCODE folks claim no conservation of elements across species – (ridiculous)
BioSci D145 lecture 7 page 17 ©copyright Bruce Blumberg All rights reserved

17. Literally “on top of genetics” coined by C.H. Waddington in 1957
What is Epigenetics ?
Literally “on top of genetics”
coined by C.H. Waddington in 1957
Epigenetics involves changes in gene expression without changes in the DNA sequence
Heritable, maintained
Reversible
Encoded in chromatin
Cellular memory
What are some examples of epigenetic phenomena ?
X inactivation
Genomic imprinting
Cancer – widespread silencing or overexpression of genes
BioSci D145 lecture 7 page 18 ©copyright Bruce Blumberg All rights reserved

18. What is Epigenetics ?
BioSci D145 lecture 7 page 19 ©copyright Bruce Blumberg All rights reserved

19. Genetics acts through DNA sequence Epigenetics acts through chromatin structure
Methylation (inactivates)/demethylation of DNA, proteins
Acetylation (activates)/deacetylation of DNA-binding proteins
Changes can act at very long range, 100s of kb to mb
from other chromosomes!
BioSci D145 lecture 7 page 20 ©copyright Bruce Blumberg All rights reserved

20. Epigenetics acts through chromatin stucture
Chromatin conformation affects accessibility of DNA to transcriptional machinery
Widespread changes in DNA methylation can be associated with diseases, e.g., cancer
BioSci D145 lecture 7 page 21 ©copyright Bruce Blumberg All rights reserved

21. Nature Insight Vol May 2007
BioSci D145 lecture 7 page 22 ©copyright Bruce Blumberg All rights reserved

22. Genetics and epigenetics of disease
Some genetic diseases
Sickle cell anemia
Cystic fibrosis
Hemophilia
Marfan syndrome
Duchenne muscular dystrophy
Huntington’s disease
Diseases with an epigenetic component (from ID twin studies)
Fragile X syndrome
Prader-Willi syndrome
Angelman’s syndrome
Autism
Schizophrenia
Inflammatory bowel disease
Various types of cancer
BioSci D145 lecture 7 page 23 ©copyright Bruce Blumberg All rights reserved

23. The DOHaD Hypothesis
Barker Hypothesis - gestational under-nutrition leads to a thrifty phenotype
reduced fetal growth is strongly associated with many cardiovascular disease and other related syndromes.
Increased susceptibility results from adaptations made by the fetus in an environment limited in its supply of nutrients
Developmental Origins of Health and Disease (Mark Hanson) more generally proposes that development is very sensitive to perturbations that lead to permanent changes in susceptibility to disease
Birth defects, low birth weight, premature birth
Functional changes – individual appears normal but has molecular abnormalities that persist and lead to increased disease sensitivity later in life
Diseases with Developmental Origins (from animal models)
Cardiovascular, Pulmonary (asthma)
Neurological (ADHD, Neurodegenerative diseases),
Immune/autoimmune
Endocrine, reproductive/fertility, cancer
Obesity/diabetes
BioSci D145 lecture 7 page 24 ©copyright Bruce Blumberg All rights reserved

24. “How We're Already Killing Our Grandkids” “Sins of the fathers, and
Three generations from the
Överkalix parish of Norrbotten
“How We're
Already Killing
Our Grandkids”
“Sins of the
fathers, and
their fathers”
“We've long been told that pregnant women can't smoke or drink or overeat or worry without doing irreparable damage to their children — now it appears that unless we want to curse the next thirteen generations of our offspring, we can't do these things ever”
“Men inherit
hidden cost of
dad's vices”
BioSci D145 lecture 7 page 25 ©copyright Bruce Blumberg All rights reserved

25. Mortality Risk of Grandchildren based on Food Availability to Grandparents (during Pre-Pubescent Period)
BioSci D145 lecture 7 page 26 ©copyright Bruce Blumberg All rights reserved

26. Mortality Risk of Grandchildren based on Food Availability to Grandparents (during Pre-Pubescent Period)
A single winter of overeating could lead to a 6 (actual) to 32 (adjusted for socioeconomic status) year decrease in longevity of paternal grandchildren
BioSci D145 lecture 7 page 27 ©copyright Bruce Blumberg All rights reserved

27. Epigenetics can be changed by environment
Maternal care – licking studies in rats
(maternal) stress
Diet - folic acid, vitamins B2, B6, B12 (influence DNA methylation)
Other dietary factors – e.g., phytoestrogens
Toxins - heavy metals, arsenic, tobacco
Maternal caloric intake (paternal, too)
Changes in DNA methylation responsible
BioSci D145 lecture 7 page 28 ©copyright Bruce Blumberg All rights reserved

28. Types of epigenetic (epigenomic) phenomena
Epigenome – changes in chromatin states that may vary from cell to cell
Epigenetics – all processes that lead to heritable changes in gene expression (during development or across generations)
Without changes in DNA sequence
Usually involves changes in chromatin therefore epigenetic inheritance often involves epigenomics.
What are some ways that epigenetic inheritance can be transmitted?
Changes in DNA methylation
Changes in histone methylation
Changes in ncRNA partitioning
lncRNAs
Small RNAs
Modified tRNAs
BioSci D145 lecture 7 page 29 ©copyright Bruce Blumberg All rights reserved

29. Genome-wide de-methylation and re-methylation
Germ cell DNA methylation is erased and then re-established
Controversial whether some regions are resistant to demethylation
Consensus is that some regions are probably resistant (imprinted loci)
How is specific pattern of DNA methylation re-established?
Template use is unlikely based on Seisenberger paper.
How are changes in methylation propagated across generations?
BioSci D145 lecture 7 page 30 ©copyright Bruce Blumberg All rights reserved

30. Techniques to study epigenetics
DNA methylation
Methylation sensitive restriction digestion (simple, fast, inexpensive)
DNA treated with bisulfite - converts C to U
Replication replaces U with T
Digest with restriction enzyme that does not cut methylated DNA
Evaluate products
Gel electrophoresis
QPCR
BioSci D145 lecture 7 page 31 ©copyright Bruce Blumberg All rights reserved

31. Techniques to study epigenetics (papers this week and next)
DNA methylation
Methylation sensitive restriction digestion (simple, fast, inexpensive)
Genome wide variation
cut with frequent digesting enzyme e.g, MseI
Add linker sequences with PCR primer
Cut with methylation sensitive restriction enzyme
PCR with primers – only detects sequences with methylated DNA between primers
Analyze by microarray or nextgen sequencing
BioSci D145 lecture 7 page 32 ©copyright Bruce Blumberg All rights reserved

32. Techniques to study epigenetics
DNA methylation
bisulfite sequencing (unmethylated C residues converted to U)
Directly sequence products of bisulfite treatment and infer degree of methylation
Mass spectrometric analysis of results
Massively parallel sequencing
3rd generation sequencing (Pacific Biosciences and Nanopore) can (supposedly) directly detect methylated DNA
BioSci D145 lecture 7 page 33 ©copyright Bruce Blumberg All rights reserved

33. Techniques to study epigenetics
DNA methylation
MeDIP – methylated DNA immunoprecipitation
Denature DNA, sonicate and immunoprecipitate with anti-methyl cytosine antibody
Identify sequences precipitated by microarray, nextgen sequencing
Methylminer-seq (MBD-seq)
Uses methylated DNA binding protein to capture meDNA
BioSci D145 lecture 7 page 34 ©copyright Bruce Blumberg All rights reserved

34. Techniques to study epigenetics
Histone modification
Histones are considerably modified at many places and in a combinatorial fashion (many permutations)
Methylation
Phosphorylation
acetylation
Only methylation is heritable!
Methods of analysis
ChIP – precipitate chromatin with antibodies specific to particular methylation
Analyze by microarray – ChIP-CHIP
Or by high throughput sequencing – ChIP-seq
BioSci D145 lecture 7 page 35 ©copyright Bruce Blumberg All rights reserved

35. H3K4me3 – pro-transcription (open) H3K4me1 (enhancers)
H3K9me3 – anti-transcription (alone)
H3K27me3 – anti-transcription H3K27ac – pro-transcription
meCpG – anti-transcription
BioSci D145 lecture 7 page 36 ©copyright Bruce Blumberg All rights reserved

36. “Open” chromatin takes multiple forms
Active promoters
H3K4me3 present
H3K4me1 at enhancers
H3K27ac at enhancer
DNAse I hypersensitive
eRNA transcribed at enhancers
Primed promoters (inactive, but receptive to activation)
H3K4me3 absent
H3K4me1 present at enhancers
5hmC, 5mC present at enhancers
Pioneer factors may be present
Poised promoters (inactive and ready to be activated)
H3K4me3 at promoter, no tx
H3K4me1, H3K27me3 in enhancers
DNAse I hypersensitive enhancer
eRNA not transcribed
BioSci D145 lecture 7 page 37 ©copyright Bruce Blumberg All rights reserved