Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genetics and Biometrics

Similar presentations


Presentation on theme: "Genetics and Biometrics"— Presentation transcript:

1 Genetics and Biometrics

2 Genetic Definitions Locus Gene
The position of a coding or non coding genetic element Gene All the nucleotide elements required for the expression of a transcript Promoter, ORF, introns, exons, etc.

3 Genetic Definitions (Cont’d)
Allele Version of a genetic element at a given locus Everyone necessarily has two alleles for each genomic locus The two alleles may be the same Homozygotes The two alleles may be different Heterozygote A population of individuals may have multiple alleles of a genomic locus

4 Genetic Definitions (Cont’d)
Genotype: Nucleic acid sequence responsable for the phenotype Physical detection by molecular techniques Phenotype: Trait that can be distinguished resulting from a genotype Several different genotypes may have the same phenotype

5 The Differences Between individuals of the same sex
<0.5% Between humans and chimpanzes <2%

6 Molecular Markers Characteristics of the nucleotide sequence
The phenotype often corressponds to a specific genotype Restriction polymorphisms (RFLP) Length polymorphisms (VNTR) Variable number of tandem repeats Single nucleotide polymorphisms (SNP)

7 Length Polymorphisms - RFLP
Based on the presence or absence of a restriction site at a given poistion Ex. The enzyme EcoR1 recognizes and cleaves the sequence: GAATTC A mutation of a single base abolishes the site GAGTTC

8 Detection of Genomic RFLP
Polymorphism 1 2 A B E A+B * E Genome 1 Genome 2 2 possible phenotypes 2 alleles can be distinguished Several possible genotypes

9 Detection of RFLP by PCR
A B E A+B * Amplification & Gel Separation Genome 1 Genome 2 1 2 1 2 After digestion Before digestion

10 Length Polymorphisms Minisatellites and Microsatellites:
Sequences repeated in tandem Highly variable number of repetitions between individuals; thus several alleles Length polymorphisms Molecular phenotype=Genotype   Minisatellites Low distribution throughout the genome Mostly found within telomeres Microsatellites: High distribution throughout the genome VNTR

11 VNTRs The number of repetitions = different lengths
= different alleles = different genotypes = different molecular phénotypes

12 Length Polymorphisms of Microsatellites
VNTR DNA Region where tandem copies of di-, tri- or tetra repeated units are located Examples: Dinucleotide repetitions GTGTGTGTGTGT…… Trinucléotide repetitions ACGACGACGACG…… Tetranucleotide repetitions TATCTATCTATC……

13 VNTR (Cont’d) Highly variable number of repetitions individuals Ex.
Thus several alleles within a population Ex. CA Allele 1 Allele 2 Allele 3 Different fragment lengths would be generated by a digestion at the indicated positions

14 Detection of VNTR by PCR
AGCTGCTTAATGCTGCTGCTGCTGCTGCTGCATAACATTGC Individual 1 AGCGGCTTAATGCTGCTGCATAACATTGC Individual 2 1 2 Amplification & gel separation

15 Biometrics

16 VNTR Profile of Nuclear Genome
From whom does the blood come from?

17 VNTR Profile of Nuclear Genome
Bob Luke Paul Tom Mark Who is Bob’s father?


Download ppt "Genetics and Biometrics"

Similar presentations


Ads by Google