1. Biotechnology

2. A Brave New World

3. human genome 3.2 billion bases
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome 3.2 billion bases

4. *The code is universal Since all living organisms… use the same DNA
use the same code book
read their genes the same way
Strong evidence for a single origin in evolutionary theory.

5. Biotechnology today Genetic Engineering Our tool kit…
manipulation of DNA
if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with
this unit is a survey of those tools…
Our tool kit…

6. Plasmids Small supplemental circles of DNA carry extra genes
,000 base pairs
self-replicating
carry extra genes
2-30 genes
genes for antibiotic resistance
can be exchanged between bacteria
remember conjugation?
rapid evolution
can be imported from environment
Mini-chromosomes

7. How can plasmids help us?
A way to get genes into bacteria easily
insert new gene into plasmid
insert plasmid into bacteria = vector
bacteria now expresses new gene
bacteria make new protein
transformed bacteria
gene from other organism
recombinant plasmid
vector
plasmid
cut DNA +
glue DNA

8. insert “gene we want” into plasmid... “glue” together
Biotechnology
Plasmids used to insert new genes into bacteria
cut DNA
gene we want
like what?
…insulin
…hGH
…lactase
cut plasmid DNA
Cut DNA?
DNA scissors?
ligase
insert “gene we want” into plasmid... “glue” together
recombinant plasmid

9. What is a Restriction Enzyme?
Restriction Enzymes recognize specific DNA sequences and cut the DNA
Restriction Enzymes can be thought of as molecular scissors

10. chromosome want to add gene to
Sticky ends
Cut two strands of DNA with same enzymes
leave “sticky ends” on both
can glue DNA together at “sticky ends”
GTAACG AATTCACGCTT
CATTGCTTAA GTGCGAA
gene you want
GGACCTG AATTCCGGATA
CCTGGACTTAA GGCCTAT
chromosome want to add gene to
GGACCTG AATTCACGCTT
CCTGGACTTAA GTGCGAA
combined DNA

11. How Restriction Enzymes Are Used

12. How do we cut DNA?(review)
Restriction enzymes
restriction endonucleases
discovered in 1960s
evolved in bacteria to cut up foreign DNA
“restrict” the action of the attacking organism
protection against viruses & other bacteria 

13. Engineered plasmids Building custom plasmids restriction enzyme sites
antibiotic resistance genes as a selectable marker
EcoRI
BamHI
HindIII
2.restriction sites
Selectable marker
antibiotic resistance gene on plasmid
ampicillin resistance
selecting for successful transformation
successful uptake of recombinant plasmid
How do we know what’s the right combination of genes on a plasmid?
Trail and error research work.
selectable markers
high copy rate
convenient restriction sites
There are companies that still develop plasmids, patent them & sell them.
Biotech companies (ex. New England BioLabs)
plasmid
1.ori
3.amp resistance

14. Selection for plasmid uptake
Antibiotic becomes a selecting agent
only bacteria with the plasmid will grow on antibiotic (ampicillin) plate
only transformed bacteria grow
all bacteria grow a a a a a a a a a a a a a a a a a
LB plate
LB/amp plate
cloning

15. Concept 13.2 DNA Can Genetically Transform Cells and Organisms
Selectable markers are a type of reporter gene—a gene for which expression is easily observed.
Two other common reporter genes:
β-galactosidase (lacZ) gene codes for an enzyme that converts a white substrate into bright blue.
Cloning plasmids may contain antibiotic resistance genes and the lacZ gene.

16. Concept 13.2 DNA Can Genetically Transform Cells and Organisms
Green fluorescent protein (GFP) from a jellyfish emits green light when exposed to UV light.
The gene for this protein is widely used as a reporter gene.

17. How can bacteria read human DNA? human insulin gene in bacteria
Why mix genes together?
Recombinant DNA: a DNA molecule made in the laboratory that is derived from two or more sources
human insulin gene in bacteria
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC aa
“new” protein from organism
ex: human insulin from bacteria
bacteria
human insulin

18. Bacteria Bacteria review one-celled prokaryotes reproduce by mitosis
binary fission
rapid growth
generation every ~20 minutes
108 (100 million) colony overnight!
dominant form of life on Earth
incredibly diverse

19. Transformation Bacteria are opportunists
promiscuous!?
Bacteria are opportunists
pick up naked foreign DNA wherever it may be hanging out
have surface transport proteins that are specialized for the uptake of naked DNA
import bits of chromosomes from other bacteria
incorporate the DNA bits into their own chromosome
express new genes
transformation
form of recombination
mix heat-killed pathogenic & non-pathogenic
bacteria
While E. coli lacks this specialized mechanism, it can be induced to take up small pieces of DNA if cultured in a medium with a relatively high concentration of calcium ions.
In biotechnology, this technique has been used to introduce foreign DNA into E. coli.
mice die

20. Methods for inserting recombinant DNA into a cell:
Cells are treated with chemicals to make plasma membranes more permeable so that DNA can diffuse in.
Electroporation—a short electric shock creates temporary pores in membranes, and DNA can enter.
Viruses can be altered to carry recombinant DNA into cells.

21. Copy (& Read) DNA Transformation
insert recombinant plasmid into bacteria
grow recombinant bacteria in agar cultures
bacteria make lots of copies of plasmid
“cloning” the plasmid
production of many copies of inserted gene
production of “new” protein
transformed phenotype
DNA  RNA  protein  trait

22. *Grow bacteria…make more
transformed bacteria
gene from other organism +
recombinant plasmid
vector
plasmid
grow bacteria
harvest (purify) protein

23. Uses of genetic engineering
Genetically modified organisms (GMO)
enabling plants to produce new proteins
Protect crops from insects: BT corn
corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)
Extend growing season: fishberries
strawberries with an anti-freezing gene from flounder
Improve quality of food: golden rice
rice producing vitamin A improves nutritional value
For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene.
Humans use beta-carotene to make vitamin A.
Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.

24. Transformed vertebrates
Green with envy??
Jelly fish “GFP”
Transformed vertebrates

25. I’m a very special pig! Got any Questions?