1. Molecular Basis of Heredity
Unit 3 / Module 6
DNA Fantastic! Song 1

2. 1. What is DNA? Structure and Function of DNA - YouTube
Importance of DNA
DNA stands for deoxyribonucleic acid. It is one of two nucleic acids found in the cell.
DNA is the blueprint for life. Every living thing uses DNA as a code for making proteins which determine traits. For example, DNA contains the instructions for making the proteins (called pigments) which give your eyes color.
My eyes are green
Because of DNA? 2

3. 1. What is DNA?
DNA is packaged into chromosomes. Each chromosome is composed of one continuous DNA molecule. The DNA molecule is wrapped around proteins and coiled tightly for protection.
Remember, chromosomes are found in the nucleus of eukaryotic cells. Prokaryotic cells have a single chromosome free-floating in the cytoplasm. 3

4. 1. What is DNA? Discovery of DNA structure
Many scientists worked to determine the source of heredity. Heredity is the passing of traits from parent to offspring. But how are those traits passed?
First, scientists determined that chromosomes controlled heredity and are made of DNA and proteins.
Then, scientists determined DNA was the chemical that controlled characteristics (traits of the organisms.
Then, the race was on to reveal the structure of the DNA molecule.
Curly hair
Is an example
Of heredity 4

5. 1. What is DNA? Structure of the DNA molecule
DNA is a double helix. The double helix looks like a twisted ladder.
The building blocks of DNA are called nucleotides. A nucleotide consists of three parts:
A sugar (named deoxyribose)
A phosphate group
One of four nitrogen bases. The four possible nitrogen bases in a DNA molecule are named:
Adenine (A)
Thymine (T)
Guanine (G)
Cytosine (C) 5

6. 1. What is DNA?
There are two strands of nucleotides in every DNA molecule held together by weak hydrogen bonds between the nitrogen bases.
The nitrogen bases bond in a specific way. Adenine bonds with thymine (A–T). Guanine bonds with cytosine (G-C). This pattern is called complementary base pairing. 6

7. II. Do all my cells have the same DNA ?
Result of DNA replication
Two identical DNA molecules have been produced. Each “daughter” DNA molecule is composed of one “old” strand and one “new” strand. (Here a “strand” refers to one chain of nucleotides.)
Each copy of DNA is packaged as a chromatid on a doubled chromosome.
After mitosis, each daughter cell will receive one of the two identical copies of DNA. This happens when the doubled chromosome is split, each new chromosome going to a new daughter cell.

8. Module 6 DNA and Protein Synthesis
Day 2 of 7
DNA Fantastic! Song

9. SWBAT
explain that DNA is a code for making proteins and that the code is found in the sequence of nitrogen bases.
determine the complementary nitrogen base sequence when given the sequence of one strand
explain the stages of DNA replication

10. 1. What is DNA?
Slide 1 of 7
Rosalind Franklin was the first to take a clear “picture” of DNA using a technique called X-ray crystallography. The “picture” offered a clue of the shape of DNA.
Rosalind Franklin: Great Minds - YouTube (4 mins)
Watson and Crick received credit for finalizing the model of DNA by using the picture taken by Franklin and by synthesizing work completed by other scientists.

11. What are the 3 parts of a nucleotide?
Slide 2 of 7
Nucleotide is the monomer for nucleic acids (a major organic molecule)
Sugar (DNA’s sugar is Deoxyribose)
Phosphate group
(together the sugar and phosphate make up the backbone of DNA’s structure)
Nitrogen base (this is where the code for heredity is stored)

12. Determining the Complementary Base Pair Sequence:
Slide 3 of 7
When given one side of the DNA template, you can determine the other side using the rules of complementary base pairing:
Ex: T A G G C T G A A C
A T C C G A C T T G
Note: The sequence above has 10 base pairs. A human has ~ 3 BILLION base pairs in their DNA!

13. II. Do all my cells have the same DNA ?
Slide 4 of 7
DNA Replication copies DNA for new cells
Because DNA is so important, when a cell divides, it must pass on an exact copy of the DNA to function correctly.
DNA gives instructions to each cell to make necessary proteins.
Therefore, DNA is replicated during the S phase of the cell cycle (part of interphase)

14. II. Do all my cells have the same DNA ?
Slide 5 of 7
Process of DNA replication DNA replication explained (1 min)
An enzyme breaks the weak hydrogen bonds between the paired nitrogen bases. This allows DNA to “unzip” as the two strands move apart.
The newly unpaired nucleotides are paired (A-T and G-C) with extra nucleotides present in the nucleus. This process is catalyzed by another enzyme. 14

15. II. Do all my cells have the same DNA ?
Slide 6 of 7
3. Enzymes then link the nucleotides along the newly constructed side of the DNA ladder by bonding sugar to phosphate.
4. The DNA is proofread by enzymes for any errors.
5. Each new DNA strand is now half original DNA and half new DNA! (Semi-Conservative)
YouTube - DNA Replication (1 min) 15

16. Replication in Action! TACATTTAACATCGGCGTATACA
Slide 7 of 7
What are the complementary bases to this DNA sequence?
(Write both in your travel journal)
DNA:
TACATTTAACATCGGCGTATACA
Complementary Strand????
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

17. SWBAT
explain that DNA is a code for making proteins and that the code is found in the sequence of nitrogen bases.
determine the complementary nitrogen base sequence when given the sequence of one strand
explain the stages of DNA replication

18. Group Activity
KAHOOT!!!!!!

19. Independent Activity Show me you know DNA replication!
On your worksheet,
A. Fill in the complementary strand.
Original DNA: TCCTGACCCCGCCGGGATAT
Complementary: AGGACTGGGGCGGCCCTATA
B. Split the DNA and fill in the complementary strands to create two complete double helix strands.
Strand 1: TCCTGACCCC (original)
AGGAC TGGGG (new)
TCCTGACCCC (new)
AGGACTGGGG (original) complementary strand from example A

20. Homework- Due Friday, March 4
Find an article about Rosalind Franklin.
Write at least 8 sentences on:
a) how her research shaped the discovery of DNA’s structure and
b) whether or not you agree with Watson and Crick’s use of her information.

21. Do Now What are the complementary base pairs of DNA?
What is the complementary strand of:
ATTACCGGATA
Where is DNA located?
What stage of Interphase does DNA replication occur?

22. Module 6- DNA and Protein Synthesis
Day 3 of 7
Transcription
(Making RNA from DNA)

23. III. How can DNA be used by the cell to make a protein?
Slide 1 of
Central Dogma
DNA → RNA → Protein
(transcription) (translation)
DNA
Replication 23

24. What is Transcription?
Slide 2 of
Transcription is the process of converting DNA into RNA so that DNA’s instructions can leave the nucleus in order to make proteins.

25. III. How can DNA be used by the cell to make a protein?
Slide 3 of
Why RNA is Just as Cool as DNA – YouTube
Process of protein synthesis
Transcription rewrites the DNA code as messenger RNA (mRNA)
DNA cannot leave the nucleus (it is far too big) to go to the ribosomes, where proteins are made. Thus, it must send the instructions using RNA.
mRNA copies the DNA when the DNA unzips a gene. One gene makes one protein. 25

26. III. How can DNA be used by the cell to make a protein?
Slide 4 of
mRNA is constructed one nucleotide at a time using one side of the DNA as a template.
All RNA has a different sugar (ribose) which cannot bond to thymine. Thus, RNA must use a different nitrogen base (uracil-U) as a substitute for thymine (T).
For example, if the DNA side read CTA the mRNA would read GAU.
mRNA leaves the nucleus through a small opening in the nuclear membrane called a pore.

27. III. How can DNA be used by the cell to make a protein?
Slide 5 of 5
Protein Synthesis and the Lean, Mean Ribosome Machines - YouTube
Importance of protein synthesis
Every inherited trait is controlled by one or more proteins. Protein synthesis is the process that makes those proteins.
Each cell must produce different proteins, based on the function of that cell. For example, only blood cells need to produce the protein hemoglobin.
Protein Synthesis
Hemoglobin

28. Transcription Practice!
Independent Practice
Transcription Practice!
This is independent work.
Show me what you know.
Gizmos- DNA and Protein Synthesis
Practice worksheet

29. Exit Ticket
On a separate sheet of paper, you will write/draw/diagram everything you know about DNA and RNA for 2 minutes.
You will keep your writing utensil moving until I say stop.
Then, copy and answer this statement:
“From everything we learned today, I can conclude that this is important because ______”

30. III. How can DNA be used by the cell to make a protein?
Central Dogma of Biology – the central axis around which all other biological concepts rotate
DNA structure controls the production of proteins.
A section of DNA which is used as the blueprint or code for the production of a protein is a gene. 30

31. Do Now Turn in your Rosalind Franklin assignment.
If I have the DNA sequence AATCGC what is the complementary sequence?
If I have the DNA sequence TACGCG what is the mRNA sequence?
If I have the mRNA sequence UGACCU, what is the original DNA sequence?

32. Module 6
Day 4 of 7
Translation
(making proteins from RNA)

33. III. How can DNA be used by the cell to make a protein?
Each gene is composed of a specific sequence of nucleotides. For example, ACGCCATGCTAC
Every three bases in this sequence is called a codon.
ACG CCA TGC TAC
A codon is like a single word in a sentence. Only by putting the words(codons) in the correct order can you create a meaningful sentence (protein).

34. III. How can DNA be used by the cell to make a protein?
Translation uses the mRNA to build a protein
In the cytoplasm of the cell, translation occurs at the ribosome. Ribosomes are made of rRNA (ribosomal RNA) and proteins.
The mRNA “start” codon (AUG) attaches to the ribosome. The ribosome holds mRNA in place and helps link amino acids together to make a protein. 34

35. Diagram of Translation

36. tRNA (transfer RNA) is a molecule that carries an amino acid to the ribosome. In order for the tRNA to leave the amino acid at the ribosome, it must bond with a codon on the mRNA.

37. III. How can DNA be used by the cell to make a protein?
Proteins are made of amino acids. Each codon directs the cell to place a specific amino acid in a particular position as the protein is built.
For example, the codon CAA in DNA codes for the amino acid “valine”.
There are 20 different amino acids made from the 4 nitrogen bases.

38. III. How can DNA be used by the cell to make a protein?
The amino acid is removed from the tRNA by an enzyme. As each new amino acid arrives on a tRNA, amino acids are bonded together IN ORDER by a peptide bond to form a polypeptide.
When the ribosome reaches a “stop” codon, it releases the mRNA and the string of amino acids separately. The string of amino acids folds and coils to shape the protein.

39. mRNA codon chart

40. III. How can DNA be used by the cell to make a protein?
Result of protein synthesis
Cells respond to their environments by producing different types and amounts of protein.
The cell produces proteins that are structural (forming part of the cell materials) or functional (such as enzymes, hormones, or chemicals for cell chemistry). 40

41. III. How can DNA be used by the cell to make a protein?
d. Each individual in a sexually reproducing population has slightly differing sequences of nucleotides in DNA when compared to other organisms of the same specie. The different sequences lead to different proteins, which produce different traits (i.e. variation). For example, two humans with different eye color. 41

42. mRNA codon chart DNA: CCA TAG CAC GTT ACA ACG TGA AGG TAA mRNA:
Amino acids:

43. Transcribe DNA into mRNA then
Independent Practice
Transcribe DNA into mRNA
then
Translate mRNA into a Protein using the Codon Chart

44. Homework- due Wed March 9
Complete the Protein Synthesis review packet (in addition to the Study Guide key tips I will provide after group activity)

45. Group Practice- Codon Bingo
Let’s play Codon BINGO!!!!!

46. Test Review Packet-Know:
The purpose of phosphate, sugar, and nitrogen bases
DNA replication makes new DNA from an _____ strand and a ____ strand.
What is the transcription?
What is translation?
How are DNA and RNA similar?
How are DNA and RNA different?
What are the three types of RNA and their function?
how to read a Codon Chart when given both DNA sequences and RNA sequences
the monomer for each major organic molecule
the function of each major organic molecule
What is the purpose of enzymes and why are they important?
Know difference between aerobic and anaerobic respiration
How are photosynthesis and cellular respiration similar? different?
What are the types of transport and how are they different?
Know the cell cycle
What is interphase?
Know the different types of mutations

47. III. How can DNA be used by the cell to make a protein?
c. All of an organism’s cells have the same DNA, but the cells differ based on the expression of the genes.
Multicellular organisms begin as undifferentiated masses of cells. Variation in DNA activity determines cell types.
Different types of cells expressing different genes leads to differentiation. Only specific parts of the DNA are activated in those cells. Once a cell differentiates, the process cannot be reversed. For example, we have muscle cells, nerve cells, and others.

48. III. How can DNA be used by the cell to make a protein?
iii. Gene regulation is the process which determines which genes will be expressed (used to make a protein). This can be affected by the cell’s history and/or environment. Proteins may be overproduced, underproduced or produced at incorrect times. Ex: Injury repair and cancer

49. IV. Whth appen swhe nprotei nsynthesi sgoe swrong?
A mutation is a change in the original DNA sequence, which may lead to a change in the amino acid sequence.
A mutation occurs when the original DNA sequence is not copied properly during replication or protein synthesis.
Mutations can be spontaneous or caused by radiation and/or chemical exposure.
C. The result of a mutation is a change in the amino acid sequence. The necessary protein may not be made or is defective. This can change the traits of the cell or organism. Only mutations in sex cells (egg and sperm) or in the gamete can result in heritable changes. 49

50. IV. Whth appen swhe nprotei nsynthesi sgoe swrong?
There are two types of gene mutations:
Point (or substitution) mutations occur when a single base is replaced with a different base. (For example, A is replaced with C.)
Ex. GATTACA → GAGTACA
A point mutation, if it occurs on a gene, may result in the change of a single amino acid within the protein.
Sickle cell anemia, a disease that results in misshapen red blood cells, is caused by a point mutation.
YouTube - Sickle Cell 50

51. IV. Whth appen swhe nprotei nsynthesi sgoe swrong?
Frameshift mutations occur when a single base is added (addition frameshift) or deleted (deletion frameshift) within the sequence. Because DNA and the mRNA copy are read three bases (a codon) at a time, this type of mutation “shifts” the reading frame.
Ex. GAT/TAC/ATT  GAT/TAA/CAT/T
The effect of a frameshift depends on the location of the addition or deletion. The earlier within the gene sequence the base is added or deleted, the more amino acids will be changed.
Huntington’s Disease, a disease that results in the progressive loss of nervous system function, may be caused by the insertion of several bases.
YouTube - DNA MUTATION
YouTube - Beneficial Mutations Do Happen 51