1. A.O. Kolo, K. Sibeko-Matjila, D. Knobel & P.T. Matjila
Molecular detection of haemoparasites in dogs in Mnisi Mpumalanga Province, South Africa
A.O. Kolo, K. Sibeko-Matjila, D. Knobel & P.T. Matjila

2. List of Contents Introduction Objectives of the Study
Materials and Methods
Results
Discussion/Conclusion
Acknowledgment

3. Introduction
Canine vector-borne diseases have a worldwide distribution and are increasingly significant as emerging diseases
Transmitted by ticks, fleas, sand flies and mosquitoes

4. Common haemoparasites of dogs
Distribution
Insect vector
Diagnosis
Control
Babesia canis
Europe
Dermacentor
Microscopy, serological tests ( IFAT, ELISA), Molecular diagnostics using PCR
Vector control by use of systemic or topically applied acaricides
B. vogelli
Southern Europe, Tropical/ semi tropical region s of world.
Dermacentor, Rhipicephalus sanguineus
Microscopy, IFAT, PCR
Vector control
B. rossi
South Africa
Haemophysalis
Rhipicephalus
B. gibsoni
Africa, Asia, Southern Europe, Middle East, USA
H. longicornis
Ehrlichia canis
Africa, Mediterranean, USA
R. sanguineus, Dermacentor
Microscopy, IFAT, PCR, isolation and cultivation
Vector control
Theileria (unnamed) specie
Rhipicephalus, Amblyomma, Haemophysalis
Anaplasma platys
Mediterranean countries, Middle East, Africa
R. sanguineus, Dermacentor
Hepatozoon canis
Africa, Southern Europe, Middle East, USA
R. sanguineus
Microscopy, IFAT
Good vector control, avoid feeding dogs with raw meat, prevent scavenging
Common haemoparasites of dogs

5. Objective of the study
Not much data is available on the haemoparasites of dogs in Mnisi
Screen blood samples from domestic dogs in Mnisi area, Bushbuckridge for haemoparasites using the reverse line blot (RLB) hybridisation assay
There is not much data available on the haemoparasites of dogs in Mnisi which is at the heart of a human-wildlife interface

6. Materials and Methods Sample collection-
141 blood samples collected from domestic dogs and stored on sterile FTA filter cards
DNA extraction- DNA was extracted from FTA cards using QIAamp DNA mini kit®(Qiagen) according to manufacturer’s instructions. Eluted DNA was stored at -20°C until further analysis by PCR

7. Materials and Methods PCR amplification Genus Target gene Primer
Primer Sequence
Babesia and Theileria
V4 region of 18S rRNA gene
RLB-F2
RLB-R2
GACACAGGGAGGTAGTGACAAG
CTAAGAATTTCACCTCTGACAGT
Ehrlichia and Anaplasma
V1 hypervariable region of 16S rRNA gene
Ehr-F
Ehr-R
GGA ATT CAG AGT TGG ATC MTG GYT CAG
CGG GAT CCC GAG
TTT GCC GGG ACT TYT TCT

8. Materials and Methods 25µl Final PCR reaction volume
Primers at final concentration of 20 pmol
5µl of DNA
Platinum Quantitative PCR super mix-UDG® (Invitrogen)
PCR grade water

9. Materials and Methods PCR conditions: optimized using a Touchdown PCR
Initial Cycle 3 min at 37°C
10 min at 94°C
10 cycles for 20 sec at 94°C, 30 sec at 67°C, 30 sec at 72°C
40 cycles of denaturation for 30 sec at 72°C
Annealing for 20 sec at 57°C
Extension for 7 min at 72°C
PCR conditions: optimized using a Touchdown PCR

10. Materials and Methods
Reverse line blot hybridisation assay- was performed on PCR products according to (Gubbels et al, 1999; Matjila et al, 2004)
PCR products were hybridized unto a membrane with specific oligonucleotide probes

11. Results
Blot 3

12. Results Number of collected samples 141
Number of samples positive for Ehrlichia/Anaplasma genus-specific probes
70 (49.6%)
Number of negative samples
51 (36.1%)
Number of samples with mixed infections
14 (9.9%)
Number of samples positive for Babesia genus-specific probe 1
31 (21.9%)
Number of samples positive for Ehrlichia canis
23 (16.3%)
Number of samples positive for Theileria/Babesia genus-specific probes
21 (14.9%)
Number of samples positive for Babesia rossi
Number of samples positive for Babesia vogelli
6 (4.25%)
Number of samples positive for Theileria genus-specific probe
3 (2.12%)
Number of samples positive for Babesia genus-specific probe 2
2 (1.4%)

13. Results Types of mixed infections Number of samples
Theileria/Babesia, Ehrlichia/Anaplasma, Babesia probe 1, B. vogelli 4
Ehrlichia/Anaplasma, Theileria/Babesia, Babesia probe 1, B. rossi 3
Ehrlichia/Anaplasma, Theileria/Babesia, Babesia probe 1, B. rossi, E. canis 2
Ehrlichia/Anaplasma, E. canis, Babesia probe 1 1
Ehrlichia/Anaplasma, E. canis, Theileria/Babesia, Babesia probe 1
B. rossi, Ehrlichia/Anaplasma, Theileria probe
Ehrlichia/Anaplasma, Theileria/Babesia
Ehrlichia/Anaplasma, Babesia probe 1, Babesia probe 2

14. Discussion/Conclusion
Ehrlichia canis is the most common haemoparasite present in dogs in Mnisi.
Almost 50% of samples tested positive for the genus-specific probe of Ehrlichia/ Anaplasma. There will be a follow-up sequencing to find out if novel species or variants of existing species are detected
14 samples (9.9%) had mixed infections which could be related to the distribution of different arthropod vectors being present on the same host at a time
After Ehrlichia canis is Babesia rossi and Babesia vogelli

15. Discussion/Conclusion
This study presents an RLB assay that simultaneously detects and differentiates all major haemoparasites that are present in dogs in Mnisi, Mpumalanga Province
The study provides preliminary data on the occurrence of haemoparasites of domestic dogs in Mnisi
The study buttresses the importance of effective control measures to prevent the transmission of these haemoparasites to domestic dogs in Mnisi, and South Africa as a whole

16. Acknowledgement Dr Kgomotso Sibeko-Matjila Prof Tshepo Matjila
Prof Darryn Knobel
Mrs Milana Troskie
Ms Ilse Vorster

17. THANK YOU!