1. Introduction to Python
BCHB524 Lecture 3
BCHB524 - Edwards

2. Outline Review Functions & Methods Defining new functions
Control flow: if statement
BCHB524 - Edwards

3. Outline Review Hello World (Printing, Execution)
Simple Numbers (Variables, Integers)
Simple Numbers II (Floats)
DNA Sequence (Strings, characters from)
DNA Sequence II (String arithmetic, methods)
BCHB524 - Edwards

4. Hello World
Printing, order of execution, comments, blank-lines, syntax errors, various errors
# Output Hello World to the terminal
print "Hello World!"
print "Hello Georgetown!"
print 'Hello Everyone'
BCHB524 - Edwards

5. Simple Numbers # Program input cars = 100 people_per_car = 4
drivers = 30
passengers = 90
# Compute the dependent values
cars_not_driven = cars - drivers
cars_driven = drivers
carpool_capacity = cars_driven * people_per_car
average_people_per_car = ( drivers + passengers ) / cars_driven
people_in_last_car = ( drivers + passengers - 1 ) % people_per_car + 1
# Output the results
print "There are", cars, "cars available."
print "There are only", drivers, "drivers available."
print "There will be", cars_not_driven, "empty cars today."
print "We can transport", carpool_capacity, "people today."
print "We have", passengers, "to carpool today."
print "We need to put about", average_people_per_car, "in each car."
print "There are", people_in_last_car, "people in the last car."
BCHB524 - Edwards

6. Simple Numbers (Review)
Variables (names) to store values
Variables to store the result of expressions
The variable name itself does not matter, but should be descriptive
Variables must have a value before you use them
Arithmetic operators +, -, *, /, % are available
Arithmetic can use variables and values
Result of integer division is an integer
BCHB524 - Edwards

7. Simple Numbers II # Program input cars = 100.0 people_per_car = 4.0
drivers = 30.0
passengers = 80.0
# Compute the dependent values
cars_not_driven = cars - drivers
cars_driven = drivers
carpool_capacity = cars_driven * people_per_car
average_people_per_car = ( drivers + passengers ) / cars_driven
people_in_last_car = ( drivers + passengers - 1 ) % people_per_car + 1
# Output the results
print "There are", cars, "cars available."
print "There are only", drivers, "drivers available."
print "There will be", cars_not_driven, "empty cars today."
print "We can transport", carpool_capacity, "people today."
print "We have", passengers, "to carpool today."
print "We need to put about", average_people_per_car, "in each car."
print "There are", people_in_last_car, "people in the last car."
BCHB524 - Edwards

8. Simple Numbers II (Review)
Numbers can be fractional (float) or integer (int).
Floats are entered using a decimal place.
Variables can store floats or ints
Arithmetic operators +, -, *, /, % are available
Arithmetic can use variables or values
Result of float division is a float
Result of arithmetic with mixed floats and ints is a float.
BCHB524 - Edwards

9. DNA Sequence # DNA is cool!
dna_sequence = 'gcatgacgttattacgactctgtgtggcgtctgctggg'
# Compute dependent values
first_nucleotide = dna_sequence[0]
last_nucleotide = dna_sequence[-1]
first_four_nucs = dna_sequence[0:4]
last_ten_nucs = dna_sequence[-10:]
sequence_length = len(dna_sequence)
# Output results
print "First nucleotide",first_nucleotide
print "Last nucleotide",last_nucleotide
print "First four nucleotides",first_four_nucs
print "Last ten nucleotides",last_ten_nucs
print "Sequence length",sequence_length
BCHB524 - Edwards

10. DNA Sequence (Review) Strings are sequences of symbols (characters)
Variables can store strings! (and ints and floats)
Access characters from a string stored in a variable using an index (integer) between [ and ]
Positive index from beginning of string 0…
Negative index from end of string -1…
The index may be stored in a variable
The index may be the result of arithmetic
Chunks of the sequence, using [s:e]
Chunk starts at index s, ends before index e.
If s is missing, start at beginning of string
If e is missing, end at end of string.
Function len(…) returns the length of the string
BCHB524 - Edwards

11. DNA Sequence II # DNA is cool!
dna_sequence = 'gcatgacgttattacgactctgtgtggcgtctgctggg'
oligo1 = 'ATTCG'
oligo2 = 'TCGAT'
# Compute dependent values, using arithmetic and string methods
ligated_oligos = oligo1 + oligo2
tandem_repeat = oligo1*6
polya = 'A'*20
in_uppercase_symbols = dna_sequence.upper()
NumberOfA = dna_sequence.count('a')
PositionOfT = dna_sequence.find('t')
rna_sequence = dna_sequence.replace('t','u')
# Output results
print "Ligated oligos",ligated_oligos
print "Tandem repeat",tandem_repeat
print "Polynucleotide run",polya
print "Uppercase",in_uppercase_symbols
print "Number of Adenine",NumberOfA
print "Position of first Thymine",PositionOfT
print "As RNA",rna_sequence
BCHB524 - Edwards

12. DNA Sequence II (Review)
Strings can be added (concatenation)
Strings can be multiplied by an integer (concatenated copies)
Upper and lower-case characters are not the same
s.find(t) → (integer) position of the string t in string s, if t is in s. Otherwise, -1.
s.count(t) → (integer) count of string t in string s.
s.upper() → upper-case version of string s.
s.replace(u,v) → string s with string u replaced by string v.
BCHB524 - Edwards

13. Conversion Functions
# There are many useful functions built into Python
aString = 'abcdefghijkl'
anInteger = 10
aFloat = 3.456
integerString = '17'
floatString = '1.234'
# Conversion
print "anInteger: before", anInteger, "after", float(anInteger)
print "aFloat: before", aFloat, "after", int(aFloat)
print "integerString: before", integerString, "after", int(integerString)
print "floatString: before", floatString, "after", float(floatString)
# Errors
print "floatString: before", floatString, "after", int(floatString)
print "aString: before", aString, "after", int(aString)
print "aString: before", aString, "after", float(aString)
print "floatString + 1:", floatString + 1
print "integerString + 1:", integerString + 1
# Figure out the internal representation
print type(anInteger), repr(anInteger), anInteger
print type(aFloat), repr(aFloat), aFloat
print type(integerString), repr(integerString), integerString
print type(floatString), repr(floatString), floatString
BCHB524 - Edwards

14. More Functions # There are many useful functions built into Python
aString = 'abcdefghijkl'
anInteger = 10
aFloat = 3.456
negativeInteger = -5
negativeFloat =
# Math
print "Absolute value:", abs(negativeInteger)
print "Absolute value:", abs(negativeFloat)
print "Min", min(anInteger,aFloat,negativeInteger,negativeFloat)
print "Max", max(anInteger,aFloat,negativeInteger,negativeFloat)
# String length
print len(aString)
# Complicated expressions!
print "Also known as 1.0:",abs(-3)*(1/float('3.0'))
print "Also known as 5: ",int(float(' '))*5
BCHB524 - Edwards

15. String Methods # String methods are very useful!
seq = 'gcatgacgttattacgactctgtgtggcgtctgctggg'
# A few important string methods
print "The number of 'a' symbols:",seq.count('a')
print "The sequence in uppercase:",seq.upper()
print "Does it end with tggg:",seq.endswith('tggg')
print "Does it start with atg:",seq.startswith('atg')
print "What position is tggg in:",seq.find('tggg')
print "After conversion to uppercase?",seq.upper().find('TGGG')
BCHB524 - Edwards

16. Defining New Functions
# Name and describe a small task (no execution!)
def helloworld():
print "Hello world"
# Functions may be parameterized by arguments
def hello(to):
print "Hello",to
# Functions can return values
def bytwo(x):
y = 2*x
return y
# Functions can be parameterized by more than one argument
def rectangle_area(length,height):
return length*height
# Continued...
BCHB524 - Edwards

17. Defining New Functions
# Continuation...
# Function execution must occur after its definition
helloworld()
hello("Georgetown")
hello("everyone")
print bytwo(2), bytwo('abcdef'), bytwo( )
x = 3
y = 4
z = 5
print bytwo(x), bytwo(y), bytwo(z)
print rectangle_area(x,y)
BCHB524 - Edwards

18. Defining New Functions
Saves typing
Reduces errors
Single change, global effect
Conceptual name aids readability
Functions can use other functions!
BCHB524 - Edwards

19. Control Flow: if statement
Execution path depends on string in seq.
Make sure you change seq to different values.
# The input DNA sequence
seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'
# Remove the initial Met codon if it is there
if seq.startswith('atg'):
print "Sequence without initial Met:",seq[3:]
else:
print "Sequence (no initial Met):",seq
BCHB524 - Edwards

20. Exercises
Download or copy-and-paste the DNA sequence of the Anthrax SASP gene from the anthrax_sasp.nuc file in the course data-directory. Treat the provided sequence as the sequence to be translated (no 5' UTR). Write a Python program to print answers to the following questions:
Does the SASP gene start with a Met codon?
Does the SASP gene have a frame 1 Met codon?
How many nucleotides in the SASP gene?
How many amino-acids in the SASP protein?
What is the GC content (% G or C nucleotides) of the SASP gene?
Test your program with other gene sequences.
BCHB524 - Edwards