Presentation is loading. Please wait.

Presentation is loading. Please wait.

Unlocking the mystery of DNA

Similar presentations


Presentation on theme: "Unlocking the mystery of DNA"— Presentation transcript:

1 Unlocking the mystery of DNA
Liz LaRosa

2 Prior to the 1950’s What we knew: Inherited characteristics are determined by genes Genes are passed from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA

3 Cell division and DNA replication
Cells divide Growth, Repair, Replacement Before cells divide, they have to double cell structures, organelles and their genetic information

4 DNA replication – Mitosis & Meiosis

5 But… What did DNA look like, and how did it replicate itself?

6 Discovering the structure of DNA
Rosalind Franklin ( ) King’s College, London Made significant advances in x- ray diffraction techniques with DNA Her images suggested that DNA had a spiral shape One of her DNA images

7 Discovering the structure of DNA
Maurice Wilkins – ( ) King’s College, London Also did X-ray diffraction studies of DNA Worked with Rosalind Franklin Shared information with Watson and Crick

8 Discovering the structure of DNA
Erwin Chargaff – ( ) Columbia University, NY Investigated the composition of DNA His findings by 1950 strongly suggested the base-pairings of A-T & G-C Met with Watson and Crick in 1952 and shared his findings “Chargaff’s rule” A = T & C = G

9 Discovering the structure of DNA
James Watson (1928) and Francis Crick ( ) Worked together at Cavendish Laboratory in Cambridge to determine the structure of DNA Used work from Franklin, Wilkins, and Chargaff to determine the double helix shape Watson, Crick, and Wilkins were awarded the Nobel Prize Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962

10 Discovering the structure of DNA
DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C)

11 DNA – What does my code look like?
Computer Code: DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases… “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

12 G A T T A C A C T A A T G T Practice DNA Base Pairs
“Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

13 DNA replication – helix unzips

14 DNA replication – helix unzips

15 DNA replication – two strands are separated

16 DNA replication – each side is now a template

17 DNA replication – two identical strands of DNA
Original DNA strands

18 DNA replication Newly assembled DNA strands

19 DNA replication Semi-conservative replication

20 Build a DNA molecule – you try it!

21 DNA replication- you try it!


Download ppt "Unlocking the mystery of DNA"

Similar presentations


Ads by Google