1. DNA – Deoxyribonucleic acid
Biology ATAR
DNA – Deoxyribonucleic acid

2. Deoxyribonucleic acid
Mitochondrial DNA
Double helix
Nucleic acid
Phospate molecule
Dioxyribose sugar
Nucleotide base
Base pairs
Adenine & Thymine
Cytosine & Guanine
Chromosomes
Genes
Protein synthesis
DNA replication
Leading strand
Lagging strand
Enzymes
DNA polymerase
DNA ligase
Keywords
Keywords

3. DNA DNA = deoxyribonucleic acid.
DNA carries the instructions for making all the structures and materials the body needs to function.
DNA is capable of self-replication.
Most of the cell’s DNA is found in the nucleus
A small amount is contained in the mitochondria.
Wellcome Images – Oliver Burston

4. Structure of the DNA molecule

5. The structure of the DNA molecule
The shape of the molecule is described as a “double helix”.
The building blocks of DNA are nucleotides.
A nucleotide consists of one phosphate molecule, a five-sided sugar molecule (deoxyribose sugar), and one nucleotide base.

6. DNA - the double helix
Wellcome Images – Peter Artymiuk

7. The structure of the double helix
Wellcome Images - Pete Jeffs

8. The ladder model
The structure of DNA can be understood more easily by untwisting the double helix and displaying the molecule as if it were a ladder.
The side rails of the ladder (the “backbone”) are alternating phosphate and sugar (deoxyribose) molecules.
The rungs are paired nucleotide base molecules held together by a weak hydrogen bond.

9. The ‘ladder’ model

10. The DNA backbone
The two side rails of the ladder run in opposite directions
These can be identified by the end of the rail which is either a three base (3’) end, or a five base (5’) end.
One strand runs from 3’ to 5’ and the opposite strand, from 5’ to 3’.

11. A nucleotide 3' 5' Nucleotide 5' 3' 5' C O 4' C C 1' 3' C C 2' OH 5'
Nitrogen base P 3' G 5' H A T
Nucleotide S S
Pentose sugar S P P
Phosphate 5' T P P H S T A S 3' S P P H C G 5' C S O S 4' C C 1' 3' 5' P 3' C C 2' OH

12. The base pairing rule
Each “rung” of the DNA ladder is formed from two nitrogen bases.
There are four bases:
adenine (A)
thymine (T)
cytosine (C)
guanine (G)
adenine always bonds with thymine (A-T)
cytosine always bonds with guanine (C-G).

13. The base pairs The binding of two nucleotides forms a base pair.
cytosine and guanine are bound together by 3 hydrogen bonds
adenine and thymine are bound by 2 hydrogen bonds
NIH - National Human Genome Research Institute

14. The base pairs Hydrogen Carbon Nitrogen Oxygen Hydrogen bond
Wellcome Images - Pete Jeffs

15. Location of DNA Most of the DNA occurs in the cell nucleus
Some DNA is also found in the mitochondria. Each mitochondrion contains 37 genes
This is referred to as mitochondrial DNA (mtDNA)
The DNA found in the nucleus is tightly coiled and packaged as chromosomes
Only sections of it are uncoiled as needed
The only time that all of the chromosomes uncoil is during cell division

16. Location of DNA

17. Histones are molecules that help to coil DNA into its chromosome structure

18. Human cells stained to show the DNA within the nuclei (blue), and the mitochondia in red.
Wellcome Images – Paul J Smith & Rachel Errington

19. The function of DNA

20. DNA & genes A chromosome consists of segments of DNA known as genes.
Each gene contains the building instructions for a specific protein.
It is estimated that there are about 20,000– 25,000 genes in the human genome (i.e. about 3 billion base pairs).

21. Reading the code
The sequence of bases is read in groups of three called codons.
Thus the sequence:
AAGCCGTTTAGAGAGATTCCT
Is read as:
AAG CCG TTT AGA GAG ATT CCT
Each codon represents one of the 20 different amino acids.

22. Prokaryotes vs. eukaryotes: DNA
circular DNA
DNA floats loose in the cytoplasm (remember, no membrane-bound organelles present)
Small number of genes
Eukaryotes
Linear DNA (in the form of a double helix)
DNA tightly packaged in the nucleus
Large number of genes

23. Eukaryotes: Mitochondrial DNA
Mitochondria contain 37 which are responsible for the production of important enzymes involved in cellular respiration.
Mitochondrial DNA is passed only from mother to child.

24. DNA replication

25. DNA replication
DNA is able to produce an exact copy of itself. This process is called DNA replication.
DNA replication occurs after cell division (mitosis) when the amount of DNA is halved.

26. DNA replication Old strand New strand
NIH - National Human Genome Research Institute

27. DNA replication
The hydrogen bonds between the nucleotide bases are broken by helicase
This ‘unzips’ the double helix, exposing the nucleotide bases
Each exposed strand acts as a template for the construction of a new DNA strand.
DNA polymerase is the enzyme that works its way along the template strand and adds new nucleotides
DNA polymerase works from the 3’ to the 5’ end of the template strand, creating the daughter strand from the 5’ to 3’ end

29. DNA replication
Replication occurs continuously along the leading strand
On the lagging strand, the new DNA is made in sections which are later joined together by DNA ligase
The fragments of newly made DNA on the lagging strand are called Okazaki fragments

30. DNA replication

31. DNA replication - summary
By LadyofHats
DNA replication