Presentation is loading. Please wait.

Presentation is loading. Please wait.

Additional file 5 Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs.

Published byBeverly Sparks Modified over 6 years ago

Similar presentations

Presentation on theme: "Additional file 5 Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs."— Presentation transcript:

1 Additional file 5 Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs of two mangrove plants    Corresponding author Following slides: Stem-loop secondary structure of precursors of the novel and conserved miRNAs. The red and green arrows indicate miRNA and miRNA* sequences, respectively. The values in the tables against the individual precursors were obtained by miRDeep2.

2 mir1, S. maritima mir1, R. mangle -miR1: AATAGGTACTGTAACTGGTATT
Total number of reads matching the sma-mir1 precursor 149 Mature sma-miR1 read count 24 Percentage of reads corresponding to mature sma-miR1 16.10 Total number of reads matching the sma-mir1 precursor 140 Mature sma-miR1 read count 26 Percentage of reads corresponding to mature sma-miR1 18.57 mir1, S. maritima mir1, R. mangle

3 mir2, R. mangle mir2, S. maritima -miR2: AGGGACCAGGAGATTGGATC
-miR2*: ACTCACTTCTTGGTCTTCGAC S. maritima Total number of reads matching the sma-mir2 precursor 164 Mature sma-miR2 read count 26 Percentage of reads corresponding to mature sma-miR2 15.85 mir2, R. mangle R. mangle Total number of reads matching the sma-mir2 precursor 65 Mature sma-miR2 read count 26 Percentage of reads corresponding to mature sma-miR2 40.00 mir2, S. maritima

4 mir3, R. mangle mir3, S. maritima -miR3: CGGAATATGGTAAAGTAGCTC
Total number of reads matching the sma-mir3 precursor 83 Mature sma-miR3 read count 30 Percentage of reads corresponding to mature sma-miR3 36.14 Total number of reads matching the sma-mir3 precursor 146 Mature sma-miR3 read count 30 Percentage of reads corresponding to mature sma-miR3 20.54 mir3, R. mangle mir3, S. maritima

5 mir4, R. mangle mir4, H. littoralis mir4, S. maritima
-miR4: CGTGGATGTTCTTATTTGGAC mir4, R. mangle mir4, H. littoralis mir4, S. maritima R. mangle H. littoralis S. maritima Total number of reads matching the sma-mir4 precursor 4 Mature sma-miR4 read count Percentage of reads corresponding to mature sma-miR4 100.00 Total number of reads matching the sma-mir4 precursor 25 Mature sma-miR4 read count 2 Percentage of reads corresponding to mature sma-miR4 8.00 Total number of reads matching the sma-mir4 precursor 50 Mature sma-miR4 read count 4 Percentage of reads corresponding to mature sma-miR4 8.00

6 mir5, R. mangle miR5, S. maritima -miR5: CTTGGTATGGAAGTTATGCATG
-miR5*: GTAATGCTCATAACTTCCCTCT R. mangle S. maritima Total number of reads matching the sma-mir5 precursor 375 Mature sma-miR5 read count 75 Percentage of reads corresponding to mature sma-miR5 20.00 Total number of reads matching the sma-mir5 precursor 393 Mature sma-miR5 read count 75 Percentage of reads corresponding to mature sma-miR5 19.08 mir5, R. mangle miR5, S. maritima

7 mir6, R. mangle mir6, S. maritima mir6, O. sativa
-miR6: GCATGGCTGTCGTCAGCTCGTG mir6, R. mangle mir6, S. maritima mir6, O. sativa R. mangle S. maritima O. sativa Total number of reads matching the sma-mir6 precursor 266 Mature sma-miR6 read count 142 Percentage of reads corresponding to mature sma-miR6 53.38 Total number of reads matching the sma-mir6 precursor 940 Mature sma-miR6 read count 149 Percentage of reads corresponding to mature sma-miR6 15.85 Total number of reads matching the sma-mir6 precursor 1657 Mature sma-miR6 read count 101 Percentage of reads corresponding to mature sma-miR6 06.00

8 mir7, R. mangle mir7, S. maritima mir7, O. sativa
-miR7: TTTTCTTGACCTTGTAAGACC mir7, R. mangle mir7, S. maritima mir7, O. sativa R. mangle S. maritima O. sativa Total number of reads matching the sma-mir7 precursor 22 Mature sma-miR7 read count Percentage of reads corresponding to mature sma-miR7 100.00 Total number of reads matching the sma-mir7 precursor 320 Mature sma-miR7 read count 50 Percentage of reads corresponding to mature sma-miR7 15.62 Total number of reads matching the sma-mir7 precursor 22 Mature sma-miR7 read count Percentage of reads corresponding to mature sma-miR7 100.00

9 mir8, R. mangle -miR8: AAAAACCCTAAACCCTAAACC R. mangle
Total number of reads matching the sma-mir8 precursor 66 Mature sma-miR8 read count 50 Percentage of reads corresponding to mature sma-miR8 75.75 mir8, R. mangle

10 mir9, R. mangle -miR9: AATACAAGCGTCGTGCTGCT R. mangle
Total number of reads matching the sma-mir9 precursor 723 Mature sma-miR9 read count 273 Percentage of reads corresponding to mature sma-miR9 37.75 mir9, R. mangle

11 mir10, R. mangle -miR10: CCCAAGATGAGTGCTCTCCT R. mangle
Total number of reads matching the sma-mir10 precursor 290 Mature sma-miR10 read count Percentage of reads corresponding to mature sma-miR10 100.00 mir10, R. mangle

12 mir11, R. mangle -miR11: TTCGGATCATTGTGCAATGTC R. mangle
Total number of reads matching the sma-mir11 precursor 13 Mature sma-miR11 read count 3 Percentage of reads corresponding to mature sma-miR11 23.07 mir11, R. mangle

13 mir12, H. littoralis mir12, R. mangle -miR12: TTGCAGGATTTTACTATTGGGT
Total number of reads matching the sma-mir12 precursor 3 Mature sma-miR12 read count 1 Percentage of reads corresponding to mature sma-miR12 33.33 Total number of reads matching the sma-mir12 precursor 15 Mature sma-miR12 read count 1 Percentage of reads corresponding to mature sma-miR12 06.66 mir12, H. littoralis mir12, R. mangle

14 mir13, R. mangle -miR13: TTAGATTCACGCACAAACTT R. mangle
Total number of reads matching the sma-mir13 precursor 133 Mature sma-miR13 read count Percentage of reads corresponding to mature sma-miR13 100.00 mir13, R. mangle

15 mir166a, R. mangle mir166a, S. maritima
-miR166a: TCGGACCAGGCTTCATTCCCC -miR166a*: GGAATGTTGTCTGGCTCGAGG mir166a, R. mangle mir166a, S. maritima

16 mir171b, R. mangle mir171b, S. maritima
-miR171b: TGATTGAGCCGTGCCAATATC mir171b, R. mangle mir171b, S. maritima

17 mir396b, R. mangle mir396b, S. maritima
-miR396b: TTCCACAGCTTTCTTGAACTT mir396b, R. mangle mir396b, S. maritima

18 mir159a, R. mangle mir159a, S. maritima
-miR159a: TTTGGATTGAAGGGAGCTCTA -miR159a*: AGAGCTCCTTGATGTCCAAA mir159a, R. mangle mir159a, S. maritima

19 mir157a, S. maritima -miR157a: TTGACAGAAGATAGAGAGCAC
-miR157a*: GCTCTCTATGCTTCTGTCATC mir157a, S. maritima

20 -miR164a: TGGAGAAGCAGGGCACGTGCA
mir164a, S. maritima

21 -miR169a: CAGCCAAGGATGACTTGCCGA
mir169a, S. maritima

Download ppt "Additional file 5 Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs."

Similar presentations

This is a template, please replace this with your data This file is at a 4 x 3 resolution This file has a 10 slides On the first slide of your presentation.

This is a template, please replace this with your data This file is at a 4 x 3 resolution This file has a 10 slides On the first slide of your presentation.
The Build-up of the Red Sequence at z

The Build-up of the Red Sequence at z
Slide 1Fig. 22.1, p.669. Slide 2Fig. 22.3, p.670.

Slide 1Fig. 22.1, p.669. Slide 2Fig. 22.3, p.670.
Slide 1Fig. 17.1, p.513. Slide 2Table 17.1, p.514.

Slide 1Fig. 17.1, p.513. Slide 2Table 17.1, p.514.
RNA Structure Prediction

RNA Structure Prediction
Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.

Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.
Where Will They Strike Next? microRNA targeting tactics in the war on gene expression Jeff Reid Miller “Lab” Baylor College of Medicine.

Where Will They Strike Next? microRNA targeting tactics in the war on gene expression Jeff Reid Miller “Lab” Baylor College of Medicine.
A convenient system for highly specific and sensitive detection of miRNA expression Xiangqi Li, Minjie Ni, Chaobao Zhang, Wubin Ma, Yonglian Zhang SUPPLEMENTAL.

A convenient system for highly specific and sensitive detection of miRNA expression Xiangqi Li, Minjie Ni, Chaobao Zhang, Wubin Ma, Yonglian Zhang SUPPLEMENTAL.
 https://es.khanacademy.org/math/cc-seventh-grade-math/cc-7th-fractions- decimals/cc-7th-fracs-to-decimals/v/converting-fractions-to-decimals-example.

 decimals/cc-7th-fracs-to-decimals/v/converting-fractions-to-decimals-example.
MicroRNA identification based on sequence and structure alignment Presented by - Neeta Jain Xiaowo Wang†, Jing Zhang†, Fei Li, Jin Gu, Tao He, Xuegong.

MicroRNA identification based on sequence and structure alignment Presented by - Neeta Jain Xiaowo Wang†, Jing Zhang†, Fei Li, Jin Gu, Tao He, Xuegong.
Computational Identification of Drosophila microRNA Genes Journal Club 09/05/03 Jared Bischof.

Computational Identification of Drosophila microRNA Genes Journal Club 09/05/03 Jared Bischof.
ANALYSIS AND VISUALIZATION OF SINGLE COPY ORTHOLOGS IN ARABIDOPSIS, LETTUCE, SUNFLOWER AND OTHER PLANT SPECIES. Alexander Kozik and Richard W. Michelmore.

ANALYSIS AND VISUALIZATION OF SINGLE COPY ORTHOLOGS IN ARABIDOPSIS, LETTUCE, SUNFLOWER AND OTHER PLANT SPECIES. Alexander Kozik and Richard W. Michelmore.
Supplemental Data Fig. 1A. Standard curves of miR-34c-5p using synthetic miRNAs.

Supplemental Data Fig. 1A. Standard curves of miR-34c-5p using synthetic miRNAs.
 Read quality  Adaptor trimming  Read sequence collapse Preprocessing Genome mapping  Map read to the spruce genome (Pabies1.0- genome.fa) using Patman-1.2.2.

 Read quality  Adaptor trimming  Read sequence collapse Preprocessing Genome mapping  Map read to the spruce genome (Pabies1.0- genome.fa) using Patman
MicroRNAs and Other Tiny Endogenous RNAs in C. elegans Annie Chiang 03.07.03 JClub Ambros et al. Curr Biol 13:807-818.

MicroRNAs and Other Tiny Endogenous RNAs in C. elegans Annie Chiang JClub Ambros et al. Curr Biol 13:
Supplementary data Modulatory role of mineral nutrients on cadmium accumulation and stress tolerance in Oryza sativa L. seedlings Abin Sebastian a, M.

Supplementary data Modulatory role of mineral nutrients on cadmium accumulation and stress tolerance in Oryza sativa L. seedlings Abin Sebastian a, M.
Copyright OpenHelix. No use or reproduction without express written consent1.

Copyright OpenHelix. No use or reproduction without express written consent1.
Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine 朱林娇 14S051044.

Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine 朱林娇 14S
MicroRNA Prediction with SCFG and MFE Structure Annotation Tim Shaw, Ying Zheng, and Bram Sebastian.

MicroRNA Prediction with SCFG and MFE Structure Annotation Tim Shaw, Ying Zheng, and Bram Sebastian.
Abstract Premise Figure 1: Flowchart pri-miRNAs were collected from miRBase 10.0 pri-miRNAs were compared to hsa and ptr genomes using BlastN and potential.

Abstract Premise Figure 1: Flowchart pri-miRNAs were collected from miRBase 10.0 pri-miRNAs were compared to hsa and ptr genomes using BlastN and potential.

Similar presentations

Ads by Google