Download presentation
Presentation is loading. Please wait.
Published byKatherine Jefferson Modified over 7 years ago
1
Copy-number estimation using Robust Multichip Analysis - Supplementary materials for the aroma.affymetrix lab session Henrik Bengtsson & Terry Speed Dept of Statistics, UC Berkeley August 7, 2007 BioC 2007
2
Affymetrix chips
3
Generic Affymetrix chip
> 1 million identical 25bp sequences * * 1.28 cm 1.28 cm 6.5 million probes/ chip Feature size: 100µm to 18µm to 11µm and now 5µm. Soon: 1µm, 0.8µm, with a huge increase in number of probes.
4
Abbreviated generic assay description
Start with target gDNA (genomic DNA) or mRNA. Obtain labeled single-stranded target DNA fragments for hybridization to the probes on the chip. After hybridization, washing, staining and scanning we get a digital image. This is summarized across pixels to probe-level intensities before we begin. They are our raw data.
5
Affymetrix probe terminology
Target DNA: ...CGTAGCCATCGGTAAGTACTCAATGATAG... ||||||||||||||||||||||||| Perfect match (PM): ATCGGTAGCCATTCATGAGTTACTA Mis-match (MM): ATCGGTAGCCATACATGAGTTACTA 25 nucleotides * other PMs Other DNA Other seq. * PM Target seq. X * * * MM
6
Affymetrix SNP chips (Mapping 10K, 100K, 500K)
7
Single Nucleotide Polymorphism (SNP)
Definition: A sequence variation such that two chromosomes may differ by a single nucleotide (A, T, C, or G). Allele A: A ...CGTAGCCATCGGTA/GTACTCAATGATAG... Allele B: G A person is either AA, AB, or BB at this SNP.
8
Probes for SNPs AA AB BB * * * * PMA: ATCGGTAGCCATTCATGAGTTACTA
Allele A: ...CGTAGCCATCGGTAAGTACTCAATGATAG... Allele B: ...CGTAGCCATCGGTAGGTACTCAATGATAG... PMB: ATCGGTAGCCATCCATGAGTTACTA (Also MMs, but not in the newer chips, so we will not use these!) * * PMA >> PMB AA * PMA ¼ PMB AB * PMA << PMB BB
9
Copy-number analysis with SNP arrays
10
Copy-number estimation using Robust Multichip Analysis (CRMA)
Preprocessing (probe signals) allelic crosstalk (or quantile) Total CN PM = PMA + PMB Summarization (SNP signals ) log-additive PM only Post-processing fragment-length (GC-content) Raw total CNs R = Reference Mij = log2(ij /Rj) chip i, probe j
11
Copy-number estimation using Robust Multichip Analysis (CRMA)
Cross-hybridization: Allele A: TCGGTAAGTACTC Allele B: TCGGTATGTACTC CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) AA * PMA >> PMB * PMA ¼ PMB AB * PMA << PMB BB
12
Copy-number estimation using Robust Multichip Analysis (CRMA)
AA TT AT CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) PMT PMA offset +
13
Copy-number estimation using Robust Multichip Analysis (CRMA)
Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) PMT PMA
14
Copy-number estimation using Robust Multichip Analysis (CRMA)
Crosstalk calibration corrects for differences in distributions too CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) log2 PM
15
Copy-number estimation using Robust Multichip Analysis (CRMA)
Crosstalk calibration corrects for differences in distributions too CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) log2 PM
16
Copy-number estimation using Robust Multichip Analysis (CRMA)
AA CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) * PM = PMA + PMB AB * * PM = PMA + PMB * BB * * PM = PMA + PMB
17
Copy-number estimation using Robust Multichip Analysis (CRMA)
Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) The log-additive model: log2(PMijk) = log2ij + log2jk + ijk sample i, SNP j, probe k. Fit using robust linear models (rlm)
18
Copy-number estimation using Robust Multichip Analysis (CRMA)
Longer fragments ) less amplified by PCR ) weaker SNP signals CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) 100K
19
Copy-number estimation using Robust Multichip Analysis (CRMA)
Longer fragments ) less amplified by PCR ) weaker SNP signals CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj) 500K
20
Copy-number estimation using Robust Multichip Analysis (CRMA)
Normalize to get same fragment-length effect for all hybridizations CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj)
21
Copy-number estimation using Robust Multichip Analysis (CRMA)
Normalize to get same fragment-length effect for all hybridizations CRMA Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj)
22
Copy-number estimation using Robust Multichip Analysis (CRMA)
Preprocessing (probe signals) allelic crosstalk (quantile) Total CNs PM=PMA+PMB Summarization (SNP signals ) log-additive (PM-only) Post-processing fragment-length (GC-content) Raw total CNs Mij = log2(ij/Rj)
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.