1. Nucleic Acids and Proteins…
Chapter 3 continued…
Nucleic Acids and Proteins…

2. Nucleic Acids

3. Nucleic acids are informational macromolecules:
Nucleic acids are polymers that store, transmit, and express hereditary (genetic) information.
DNA = deoxyribonucleic acid
RNA = ribonucleic acid
The monomers are nucleotides.

4. Nucleotides vs nucleosides:
Nucleotide: pentose sugar + N-containing base + phosphate group
Nucleosides: pentose sugar + N-containing base

5. Bases:
Pyrimidines—single rings
Purines—double rings
Sugars:
DNA contains deoxyribose
RNA contains ribose

6. Nucleotides bond in condensation reactions to form phosphodiester bonds.
The linkage is between the #5 carbon of one ribose and the #3 carbon of the next ribose.
Nucleic acids grow in the 5′ to 3′ direction.

7. Oligonucleotides have up to 20 monomers.
Example: small RNA molecules important for DNA replication and gene expression.
“Oligos” can be synthesized for use in molecular biology experiments – these are called “primers”
DNA and RNA are polynucleotides, the longest polymers in the living world.

8. Complimentary base pairing: Apple Tart or Grilled Cheese?
Base pairs are linked by hydrogen bonds, favored by the arrangement of polar bonds in the bases.
There are so many hydrogen bonds in DNA and RNA that they form a fairly strong attraction, but not as strong as covalent bonds.
Thus, base pairs can be separated with only a small amount of energy.

9. In RNA, the base pairs are A–U and C–G.
RNA is usually single-stranded, but may be folded into 3-D structures by hydrogen bonding.
Folding occurs by complementary base pairing, so structure is determined by the order of bases.

10. DNA is usually double stranded.
Two polynucleotide strands form a “ladder” that twists into a double helix.
Sugar-phosphate groups form the sides of the ladder, the hydrogen- bonded bases form the rungs.

11. Number of separate strands Three-dimensional structure
RNA and DNA
Working in pairs or small groups, compare RNA and DNA with respect to the following aspects of their structure:
Sugar
Bases
Number of separate strands
Three-dimensional structure
Draw the complementary base pairing that occurs in DNA. Be sure to indicate the hydrogen bonds.
Instructor’s note:
Drawing should indicate pairing between adenine and thymine with two hydrogen bonds and pairing between cytosine and guanine with three hydrogen bonds. Final drawings can be compared to the figures on pages 40 and 41 of the textbook.
Answers:
Ribose in RNA and deoxyribose in DNA.
Adenine, cytosine, guanine, and uracil in RNA; adenine, cytosine, guanine, and thymine in DNA.
Number of separate strands: single in RNA and double in DNA.
Diverse three-dimensional structures in RNA (structure determined by particular order of bases) and double helix in DNA. 11

12. DNA replication: the entire molecule must be replicated completely so that each new cell receives a complete set of DNA.
Genome—complete set of DNA in a living organism
Genes—DNA sequences that encode specific proteins and are transcribed into RNA
Gene expression: transcription and translation of a specific gene.
Not all genes are transcribed in all cells of an organism.

13. DNA replication and transcription depend on base pairing: 5′-TCAGCA-3′
3′-AGTCGT-5′
transcribes to RNA with the
sequence 5′-UCAGCA-3′.
You do not need to know this…for now.
DNA’s information is encoded in the sequence of bases. DNA has two functions:
Replication
Information is copied to RNA and used to specify amino acid sequences in proteins.

15. DNA replication and transcription
This DNA sequence is one of two strands in a double helix:
5′ - AGCATTGCTAGCGTA - 3′
Write the nucleotide sequence of each of the following, making sure to label the 5′ and 3′ ends of each molecule:
The complementary DNA strand
The RNA strand transcribed from the above DNA strand
The RNA strand transcribed from the complementary DNA strand.
Answers:
1. 5′ - TCGTAACGATCGCAT- 3′
2. 5′ - UCGUAACGAUCGCAU- 3′
3. 5′ - AGCAUUGCUAGCGUA - 3′ 15

16. 5′ - AUCCAAGAUUCGCAUAGCGAAUGAUCCC - 3′
Base pairing in RNA
Copy the strand of RNA shown below, then find two complementary sequences that are four bases in length, and underline them.
5′ - AUCCAAGAUUCGCAUAGCGAAUGAUCCC - 3′
Draw the resulting molecule with those two sequences base paired to each other. Include the individual bases (letters, not structures) in your drawing.
Instructor’s note:
Students should draw these two sequences base-paired with a small loop between them.
Answer:
5′ - AUCCAAGAUUCGCAUAGCGAAUGAUCCC - 3′ 16

17. Proteins

18. Important terms: Amino acid: protein monomer
Peptide: Two or more amino acids covalently bonded together with peptide bonds.
Polypeptide: A chain of many amino acids joined by peptide bonds.
Protein: A polypeptide that has been folded into a particular shape and has a function.

19. Major functions of proteins:
Enzymes—catalytic molecules
Defensive proteins (e.g., antibodies)
Hormonal and regulatory proteins—control physiological processes
Receptor proteins—receive and respond to molecular signals
Structural proteins—physical stability and movement
Transport proteins—carry substances (e.g., hemoglobin)
Genetic regulatory proteins—regulate when, how, and to what extent a gene is expressed

20. Proteins in cells:

21. Protein structure: Protein monomers are amino acids.
Amino and carboxyl functional groups allow them to act as both acid and base.

22. Condensation (dehydration) reaction forms peptide bonds:

23. There are 20 different amino acids:

24. Cysteine—Serine—Glutamic Acid—Valine
Primary structure of proteins
Using Table 3.14 of page 27 in your textbook (showing amino acid structures) as a guide, draw a short peptide that has the following sequence:
Cysteine—Serine—Glutamic Acid—Valine
Be sure to include the molecular details of the side chains, as well as the “backbone” of the chain. 24

26. This is the tertiary structure of a single protein (polypeptide chain)

27. Tertiary and quaternary structure:

28. Hydrophobic interactions
Tertiary:
Quaternary:
Hydrogen bonds
Disulfide bridges
Hydrogen bonds
Ionic interactions
Hydrophobic interactions

29. Protein structure
Working in pairs and not looking at your notes or the textbook, describe the following levels of protein structure, including the types of bonds or interactions responsible for each level.
1. Primary structure
2. Secondary structure
3. Tertiary structure
4. Quaternary structure
Answers:
The primary structure of a protein is the precise sequence of amino acids in a polypeptide chain. It is established by covalent bonds (a peptide linkage between a carboxyl group and an amino group).
The secondary structure consists of regular, repeated spatial patterns ( helix or  pleated sheet). It is established by hydrogen bonding between amino acids of the primary structure.
Tertiary structure is the protein’s three-dimensional shape. It is determined by interactions between R groups (side chains).
Quaternary structure describes the interactions between a protein’s two or more polypeptide chains (subunits). Subunits can be held together, for example, by hydrophobic interactions, hydrogen bonds, and ionic interactions. 29

30. Predict where you would find nonpolar amino acids in this transmembrane protein. How about polar amino acids?

31. Protein denaturation (and refolding):
Denaturation is a process in which proteins lose their quaternary, tertiary, and secondary structure by application of some external stress or compound such as a strong acid or base, a high salt concentration, a  solvent such as alcohol, radiation, or heat.
Some proteins can refold if the stressor (Ex. heat) is removed.

32. Chaperones assist in protein folding:
Two models of chaperone proteins.
They make sure that primary polypeptides are held in the correct orientation for folding, or they may re-fold proteins that were misfolded.

33. Why is protein folding important?
TSEs (transmissible spongiform encephalopathies) are the result of infectious misfolded proteins called prions.
Proteins also aggragate in Alzheimers and Parkinsons diseases.
Brain tissue from a human who died from CJD)

34. Work with your group to complete the investigation on protein folding.