1. Biofilm Formation by Listeria monocytogenes and Helicobacter pylori
By : Maryam Behmabesh

2. Definition of Biofilm
Although there are several different definitions, from the engineering point of view it is generally accepted that a biofilm can be defined as an accumulation of microbial cells (bacteria, fungi, and/or protozoa) enclosed in a Self Produced Matrix of EPS and attached to a surface.
EPS = Extracellular polymeric substances

3. Several studies have shown that Biofilms may have greater than 100- fold increase in tolerance to antimicrobial agents when compared to the same bacteria in a Planktonic state.

4. History
1674. Biofilms have been described in many systems since Antonie van Leeuwenhoek observed for the first time the “animalcules” that he scraped from his own teeth, using a primitive microscope
20th century. Heukelekian and Heller and Zobell reported that the number of cells on the surface was considerably higher than in the surrounding medium.
1978. In, the general theory of microbial biofilm predominance was put forth; afterward, much progress in technology and experimental procedures has allowed more detailed descriptions of biofilms, although currently there is still some divergence in the definition of the term “biofilm.”

5. Biofilm Formation
Schematic representation of steps involved in biofilm formation on a surface.

6. Four Stages of Biofilm Formation:1
Initial attachment by planktonic cells 2
Irreversible attachment by the production of EPS 3
Maturation I 4
Maturation II 5
Detachment

7. Distinction Between Biofilms
Signal molecules
Surface
adhesion and
motility
Cell
architecture
and
differentiation
Quorum
-sensing
Biofilm cells
dispersion
Signal molecules
Biofilm
maturation
Schematic model for quorum-sensing control for surface adhesion by bacteria. 7

8. Van der Waals attraction forces Brownian Motion Gravitational Forces
Bacterial adhesion
An initial attraction of cells toward a surface due to:
Van der Waals attraction forces
Brownian
Motion
Gravitational Forces
Electrostatic Charges
Hydrophobic Interactions

9. Extracellular Polymeric Substances
Bacterial adhesion
Molecular and Cellular Interactions by Use of microbial surface structures such as:
Pili
Fimbriae
Extracellular Polymeric Substances

10. Factors Effecting Biofilm Development
Factors Influencing Biofilm Formation
Adapted from R.M. Donlan, Biofilms: microbial life on surfaces, Emerging Infectious Diseases (2002)
Cell
Aqueous Medium
Support
Hydrophobicity and chemical composition of surface
Temperature
Texture
Presence of fimbriae and flagella pH
Hydrophobicity
Extracellular polymeric compounds
Flow velocity
Surface chemistry
Quorum sensing
Ionic strength
Charge
Nutrient levels
Conditioning film

11. Therapeutic strategies against biofilm
Enzymes
Ultrasonic Treatment
Tissue plasminogen activator
Bacteriophages
Quorum Sensing Inhibitors
Silver Nanoparticles
Various Sanitizers such as Sodium Hypochlorite (NaOCl)
Ultraviolet (UV)-C
Therapeutic strategies against biofilm
NEW
NEW

12. Fit-L Antibacterial Produce Cleaner
Composition of tested QACs-based sanitizers (Quaternary Ammonium-based sanitizers) and phenolic based sanitizers
In-use concentration/dilution
Composition
Cleaner/Sanitizer
1:128
7.66% amylphenol
9.09% phenylphenol
Vesphene® IIse
200 ppm
5.25% sodium hypochlorite
FS Formula 12167™
660 ppm
10.14% didecyl dimethyl ammonium chloride
Micronex®
6.76% n-alkyl (C1450%, C1240%, C1610%) dimethyl benzyl ammonium chloride
1:88
0.5% levulinic acid
0.05% sodium dodecyl sulfate
Fit-L Antibacterial Produce Cleaner
195 ppm
5.0% n-alkyl (60%C14, 30%C16, 5%C12, 5%C18) dimethyl benzyl ammonium chlorides
Zep-amine A™
5.0% n-alkyl (68% C12, 32% C14) dimethyl ethylbenzyl ammonium chlorides

13. Pseudomonas aeruginosa
Citrobacter
Bacillus anthracis
E.coli
Listeria
Helicobacter pylori
Pseudomonas aeruginosa
Bacillus cereus
Bacillus subtilis
Bacterias:

14. The hazards of biofilm
In chronic indwelling medical devices such as central venous catheters
joint implant devices
Dialysis access devices
Cardiovascular devices
Urinary catheters
Voice prostheses
Dental implants
Stents
Ocular implants
Prolonged intensive care units
Navy
Water pipe

15. 13. New threat to long-term space missions Pseudomonas aeruginosa
Continue …
(New)
13. New threat to long-term space missions Pseudomonas aeruginosa

16. The benefits of biofilms
Sources of carbon and amino acids for plankton and fish Such as Crap fish
Protection of soil and ground water
Biological filtration of industrial waste water
Bioremediation of hazardous materials and site drainage

17. 12. Breast milk, created the healthy biofilm
Continue …
(New)
12. Breast milk, created the healthy biofilm

18. Quantitative image analysis to characterize the dynamics of Listeria Monocytogenes biofilms
To show the combination of two-dimensional (2D) and three dimensional (3D) analyses of images acquired by confocal laser scanning microscopy facilitates the quantitative spatiotemporal characterization of architectures formed by Listeria Monocytogenes biofilms

19. Listeria Monocytogenes: a major concern in the food industry
European Food Safety Authority report (EFSA and ECDC,2015) still indicates a substantial number of food-related listeriosis outbreaks.

20. In particular, the analysis of structural features such as :
Maximum Thickness
Maximum Diffusion Distance Allowed Alucidating Differences in Biofilm Formation
Bio Volume
Areal Porosity
L. Monocytogenes strains (L1A1, CECT5873 and CECT4032).

21. The analysis showed a common sequence for all strains:
In the first phase: independent clusters evolve to interconnected clusters and honeycomb-like structures.
In the second phase: Flat biofilms characterized.
In the third phase: The structures disappear.
The duration of the phases differed from strain to strain
Also,
The number of dead cells varies significantly from strain to strain

22. The complexity of biofilm architectures has motivated the development of an array of microscopic techniques to study them.
Atomic forces microscopy (AFM)
Wide-field fluorescence microscopy(WFM)
Scanning electron microscopy (SEM)
Confocal laser scanner microscopy (CLSM)
Software tools for image analysis: PHLIP

23. Biofilms states at five sampling times of
A: L1A1,
B: CECT 5873
C: CETC 4032 strains
from 24 h to 120 h as shown in IMARIS blend view mode.

24. Maximum thickness (MxT) and B. Bio volume (BV) determinations for L1
Maximum thickness (MxT) and B. Bio volume (BV) determinations for L1.A1 biofilms (blue), CECT5873 biofilms (red) and CECT4032 biofilms (green).Dots correspond to mean value; dark shades correspond to 75% confidence region.

25. Detection of Helicobacter pylori in biofilms by real-time PCR
A cause of the peptic ulcer disease and of gastric cancer
Waterborne organism
Pathogens in drinking water
The primary mode of transmission remains undetermined
Transmission routes : fecal–oral and oral–oral
Cannot be easily cultivated
Helicobacter pylori is a (VBNC) bacteria
Viable but nonculturable 

26. The aims of this study:
Establish an exact and reliable detection and quantification method for H. pylori by real-time PCR especially for biofilms.
The method was established for untreated water and freshwater- samples and adjusted for the detection of H. pylori within biofilms.
Additionally the influence of the biofilm on the sensitivity of the real-time PCR and the resulting loss of detectable cells was investigated.
The results may then be used as a basis for a risk assessment concerning the possible acquisition of H. pylori via drinking water.

27. special property of H. pylori: urease++
C = O(NH) +H +2HO HCO +2(NH) 22234
Urea Bicarbonate Ammonium
Ure A & Ure B

28. Materials and methods Biofilm growth
Bacterial strains, growth conditions and cell preparation
Cultivation and biofilm formation in a closed circuit
Microscopy
Biofilm: sampling and cell count
Helicobacter pylori: cell count
Molecular–biological methods
Isolation
Sequencing
Quantitative real-time PCR (QRTPCR) analysis

29. Validation of the Real-Time PCR
Primer and Probe specificity
selected probe and primers of the: Urea gene
Cross-homology microorganisms: Helicobacter salomonis
(mutant with a clarithromycin-resistance) Negative control: E. coli K12
(for facal bacteria)
DNA extracted from Drinking water biofilms

30. Quantitative Real-Time PCR (QRTPCR) analysis
Primer and Probe sequences :
Probe : HpyP1:6FAMAAACTCGTAACCGTGCATACCCCTATTGAG-TAMRA
Primer : HpyF1: GGGTATTGAAGCGATGTTTCCT
and
HpyR1: GCTTTTTTGCCTTCGTTGATAGT
The selected target gene for the quantitative real-time PCR(QRTPCR) analysis was the Urea gene subunit urea from H. pylori.

31. Detection of H. pylori in natural samples
(untreated biofilm)
Positive signal from un spiked drinking water biofilms by QRTPCR. One of two 30-month-old biofilms showed a positive signal for H. pylori close to the detection limit.