1. La gestione personalizzata delle malattie infettive
Friday, February 19th, 2016
La gestione personalizzata delle malattie infettive
Chiara Azzari
Pediatric Immunology Division
University of Florence
Anna Meyer Children Hospital
Jeffrey Modell Center for Immunodeficiencies

2. After 6 hours: Shock, Coma, death.
Marco, 18 years old
Fever,
High white blood cell count: (WBC=72.000)
After 6 hours: Shock, Coma, death.
Culture analyses: NEGATIVE
infective hypothesis was not considered
Diagnosis: acute leukemia 2

3. Culture method is considered the gold standard, however...
The culture methods requires large volume samples
time (hours) after antibiotic treatment
POSITIVE
NEGATIVE
the time required to sterilize the cerebrospinal fluid (CSF)
of children affected by meningococcal meningitis (MM).

4. What is the cause of the death of Marco?
After 3 days,
younger brother,
Giulio, 12 years old
Fever, poor clinical conditions
What is the cause of the death of Marco?
Leukemia or sepsis?
Realtime PCR (postmortem specimens):
meningococcus type C 4

5. Rate of culture-positivity in invasive meningococcal infection
(all cases were positive with RT-PCR)
Among 55 CSF samples positive with RT-PCR, 22/55 (38,6%) were positive in culture too
(McNemar’s p < 10-3 )
Among 43 blood samples (positive with RT-PCR), 11/43 (25,6%) were positive in culture too
(McNemar’s p < 10-3)
Azzari, Nieddu et al., 2014

6. High sensitivity

7. Underestimation Factor in blood culture 3.57
What is the rate of culture underestimation for the
Meningoccoccal infections?
Underestimation Factor in blood culture
Underestimation Factor in CSF culture
Underestimation Average
Azzari, Nieddu et al., Vaccine 2014

8. What are the real figures for meningococcus invasive disease in Italy ?
SIMI – ISS Data
PCR Data

9. Incidence of invasive pneumococcal disease among children
COLTURE-BASED METHOD 60 50 40 30
Cases x 20
<1
11,2
<2
11,5 10
<5
4,7
<14
3,6
Years old
Azzari C, et al J Med Microbiol 2008 9

10. Incidence of invasive pneumococcal disease among children
MOLECULAR METHOD 60
<1
55,8
<2
51,8 50 40
<5
35,1
Cases x 30
<14
19,9 20 10
Years old
Azzari C, et al J Med Microbiol 2008 10

11. Center for Disease Control,
Atlanta, USA

12. In 43 / 90 cases (48%) chemoprophylaxis was useless. 56
PCR vs Culture bacterial meningitidis
1 salmonella
2 S.aureus
2 pneumococcus
PCR 6 72
1 pseudomonas
47 meningococcus
24 pneumococcus
7 S. agalactiae
8 Others
Culture 90 25 32 9
4 HI nt
In 43 / 90 cases (48%) chemoprophylaxis was useless. 56
Meningococcus
Pneumococcus
HI nt
not determined
S. agalactiae
others
Azzari, Nieddu et al., Vaccine 2014

13. We work for every single patient
but we are also part of Public Health

14. Meningitis clusterTuscany 2015
January 6th 2015
23 cases Jan-April
38 cases in 2015
33 C (8 deaths)
4 B
1 W
A hypervirulent clone?

15. The capsule
can be: A B C
W135 Y
Capsular Polisaccharide
(antigene self)
Invasivity and virulence is dependent on subcapsular proteins
N.meningitidis

16. Subcapsular protein sequence
Which vaccination campaign?
The “mix” of subcapsular proteins identifies the hypervirulent clone ST11
Capsule: C, subcapsular proteins: ST11

17. The decision is: vaccination with tetravalent A,C. W
The decision is: vaccination with tetravalent A,C.W.Y meningococcal vaccine
CONJUGATION - THE PROCESS OF EXCHANGING GENETIC MATERIAL THROUGH CELL-TO-CELL CONTACT (Conjugation bridge). During conjugation, DNA Moves from one bacteria cell to another, this allows the DNA to change and provide VARIATIONS and DIVERSITY of the generations of bacteria to follow.  It Increases the chances that some bacteria will survive the environment changes. The bacteria attached together using special hairlike structures called PILI, a bridge of cytoplasm (CONJUGATION BRIDGE) forms between two bacteria cells, and the DNA passes from one cell to another.
Neisseria meningitidis (as other bacteria) is able to share part of genetic material (as capsule gene) with other.
A hypervirulent ST11 with capsule C can become a Hypervirulent ST11 with capsule Y or W.

18. aware and sustainable decisions
We work for every single patient
But we are also part of Public Health
And we base
aware and sustainable decisions
on our data

19. no amplification Carlo, 16 years old Pharyngitis
bilateral pneumonia, bilateral empyema bone abscesses ,
purulent fluid surrounding the pelvic organs
no amplification
Realtime PCR panels:

20. The 16S rRNA gene is universal in bacteria
with sufficient interspecific polymorphisms
the comparison of the 16S rRNA gene sequences allows
differentiation between organisms

21. and Hyperbaric treatment
Carlo, 16 years old
Fusobacterium
necrophorum
Pharyngitis
bilateral pneumonia, bilateral empyema bone abscesses ,
purulent fluid surrounding the pelvic organs
Lemierre's syndrome
specific antibiotics
and Hyperbaric treatment
Realtime PCR panels:
no amplification

22. If a 1000 bp sequence (330 aa) belongs to a sufficently variable gene, the answer will be unequivocable

23. ATTCGGTCGTACTGCATTGGCTAC……
I have a dream,
that my four little children will one day live
in a nation where they will not be judged
by the color of their skin
but by the content of their character.
I have a dream today!
One day right there in Alabama
little black boys and little black girls
will be able to join hands
with little white boys and white girls
as sisters and brothers.
Martin Luther King Jr. August 28, 1963
ATTCGGTCGTACTGCATTGGCTAC……
300 characters

24. Pediatric Immunology Division
University of Florence - A.Meyer Children’s Hospital
Jeffrey Modell Center for Immunodeficiencies