Download presentation
Presentation is loading. Please wait.
Published byEllen Conley Modified over 6 years ago
1
La gestione personalizzata delle malattie infettive
Friday, February 19th, 2016 La gestione personalizzata delle malattie infettive Chiara Azzari Pediatric Immunology Division University of Florence Anna Meyer Children Hospital Jeffrey Modell Center for Immunodeficiencies
2
After 6 hours: Shock, Coma, death.
Marco, 18 years old Fever, High white blood cell count: (WBC=72.000) After 6 hours: Shock, Coma, death. Culture analyses: NEGATIVE infective hypothesis was not considered Diagnosis: acute leukemia 2
3
Culture method is considered the gold standard, however...
The culture methods requires large volume samples time (hours) after antibiotic treatment POSITIVE NEGATIVE the time required to sterilize the cerebrospinal fluid (CSF) of children affected by meningococcal meningitis (MM).
4
What is the cause of the death of Marco?
After 3 days, younger brother, Giulio, 12 years old Fever, poor clinical conditions What is the cause of the death of Marco? Leukemia or sepsis? Realtime PCR (postmortem specimens): meningococcus type C 4
5
Rate of culture-positivity in invasive meningococcal infection
(all cases were positive with RT-PCR) Among 55 CSF samples positive with RT-PCR, 22/55 (38,6%) were positive in culture too (McNemar’s p < 10-3 ) Among 43 blood samples (positive with RT-PCR), 11/43 (25,6%) were positive in culture too (McNemar’s p < 10-3) Azzari, Nieddu et al., 2014
6
High sensitivity
7
Underestimation Factor in blood culture 3.57
What is the rate of culture underestimation for the Meningoccoccal infections? Underestimation Factor in blood culture Underestimation Factor in CSF culture Underestimation Average Azzari, Nieddu et al., Vaccine 2014
8
What are the real figures for meningococcus invasive disease in Italy ?
SIMI – ISS Data PCR Data
9
Incidence of invasive pneumococcal disease among children
COLTURE-BASED METHOD 60 50 40 30 Cases x 20 <1 11,2 <2 11,5 10 <5 4,7 <14 3,6 Years old Azzari C, et al J Med Microbiol 2008 9
10
Incidence of invasive pneumococcal disease among children
MOLECULAR METHOD 60 <1 55,8 <2 51,8 50 40 <5 35,1 Cases x 30 <14 19,9 20 10 Years old Azzari C, et al J Med Microbiol 2008 10
11
Center for Disease Control,
Atlanta, USA
12
In 43 / 90 cases (48%) chemoprophylaxis was useless. 56
PCR vs Culture bacterial meningitidis 1 salmonella 2 S.aureus 2 pneumococcus PCR 6 72 1 pseudomonas 47 meningococcus 24 pneumococcus 7 S. agalactiae 8 Others Culture 90 25 32 9 4 HI nt In 43 / 90 cases (48%) chemoprophylaxis was useless. 56 Meningococcus Pneumococcus HI nt not determined S. agalactiae others Azzari, Nieddu et al., Vaccine 2014
13
We work for every single patient
but we are also part of Public Health
14
Meningitis clusterTuscany 2015
January 6th 2015 23 cases Jan-April 38 cases in 2015 33 C (8 deaths) 4 B 1 W A hypervirulent clone?
15
The capsule can be: A B C W135 Y Capsular Polisaccharide (antigene self) Invasivity and virulence is dependent on subcapsular proteins N.meningitidis
16
Subcapsular protein sequence
Which vaccination campaign? The “mix” of subcapsular proteins identifies the hypervirulent clone ST11 Capsule: C, subcapsular proteins: ST11
17
The decision is: vaccination with tetravalent A,C. W
The decision is: vaccination with tetravalent A,C.W.Y meningococcal vaccine CONJUGATION - THE PROCESS OF EXCHANGING GENETIC MATERIAL THROUGH CELL-TO-CELL CONTACT (Conjugation bridge). During conjugation, DNA Moves from one bacteria cell to another, this allows the DNA to change and provide VARIATIONS and DIVERSITY of the generations of bacteria to follow. It Increases the chances that some bacteria will survive the environment changes. The bacteria attached together using special hairlike structures called PILI, a bridge of cytoplasm (CONJUGATION BRIDGE) forms between two bacteria cells, and the DNA passes from one cell to another. Neisseria meningitidis (as other bacteria) is able to share part of genetic material (as capsule gene) with other. A hypervirulent ST11 with capsule C can become a Hypervirulent ST11 with capsule Y or W.
18
aware and sustainable decisions
We work for every single patient But we are also part of Public Health And we base aware and sustainable decisions on our data
19
no amplification Carlo, 16 years old Pharyngitis
bilateral pneumonia, bilateral empyema bone abscesses , purulent fluid surrounding the pelvic organs no amplification Realtime PCR panels:
20
The 16S rRNA gene is universal in bacteria
with sufficient interspecific polymorphisms the comparison of the 16S rRNA gene sequences allows differentiation between organisms
21
and Hyperbaric treatment
Carlo, 16 years old Fusobacterium necrophorum Pharyngitis bilateral pneumonia, bilateral empyema bone abscesses , purulent fluid surrounding the pelvic organs Lemierre's syndrome specific antibiotics and Hyperbaric treatment Realtime PCR panels: no amplification
22
If a 1000 bp sequence (330 aa) belongs to a sufficently variable gene, the answer will be unequivocable
23
ATTCGGTCGTACTGCATTGGCTAC……
I have a dream, that my four little children will one day live in a nation where they will not be judged by the color of their skin but by the content of their character. I have a dream today! One day right there in Alabama little black boys and little black girls will be able to join hands with little white boys and white girls as sisters and brothers. Martin Luther King Jr. August 28, 1963 ATTCGGTCGTACTGCATTGGCTAC…… 300 characters
24
Pediatric Immunology Division
University of Florence - A.Meyer Children’s Hospital Jeffrey Modell Center for Immunodeficiencies
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.