1. Application of Bioinformatics, Proteomics, and Genomics (ABPG)
Introns, Spcicing, and
Alternative splicing

2. Out of the coding business

3. STATISTICS 92% of mammalian genes have exon/intron
structures while only 8% of genes are intron-free
The average segmented gene of these species
contains between 8 and 9 introns
The total length of human introns exceeds one
billion nucleotides, representing 35-40% of the
euchromatic part of our genome
The average size of human introns is about 5,500 bp, while the median is approximately 1,500 bp.

4. Introns are notorious for controversies over interpretation of their origin and function
40-year dispute between introns-late
and introns-early theories

5. What do we know about introns?
Introns are the ubiquitous genomic elements of eukaryotes whose role is still poorly understood and appreciated.

6. Tree of life

7. Many human introns are extremely long:
1,234 human introns are longer than 100 kb
299 are longer than 200 kb
9 are longer than 500 kb
Largest human genes:
cell recognition molecule Caspr2 2.3Mb (25 introns)
Dystrophin (DMD) Mb (78 introns)
CUB and Sushi multiple domains Mb (70 introns)
Maximal number of introns in a human gene:
titin isoform N2-A introns (cds=80,870bp)

8. Paradox with extra-large introns
Splicing junctions (intron 5`- and 3`-termini) must be brought closely together by the spliceosome in order to remove an intron from the pre-mRNA. The larger the intron, the more remote its ends are from one another.
5`-end
3`-end
intron
Removal of an intron
during splicing

9. Comparative size of 100 kB intron
Theoretically, the difficulty of bringing intron’s termini together in our 3-D world is proportional to the cube of its length -- L3, where L is the length of an intron. Therefore, for a 100,000 nt long intron, it is one million times harder to bring its ends together than for a 1000 nt long intron.
Comparative size of 100 kB intron

10. The enormous intron size in mammals creates several drawbacks, such as:
considerable waste of energy during gene expression, which is “unwisely” spent on polymerizing extra-long intronic segments of pre-mRNA molecules;
delay in obtaining protein products (on average it takes about 45 min for RNA polymerase II to transcribe a 100,000 bp intron);
potential errors in normal splicing, since long introns contain numerous false splice sites (so-called pseudo-exons).
Some benefits must be associated with introns to compensate for these disadvantages.
Different constructive roles for introns are described in two reviews:
Fedorova L., Fedorov A. Introns in gene evolution. Genetica 2003, 118:
Fedorova L., Fedorov A. Puzzles of the human genome: why do we need our introns?
Current Genomics 2005, Vol. 6,

11. Intron functions 1) sources of non-coding RNA
2) carriers of transcription regulatory elements
3) actors in alternative and trans-splicing
4) enhancers of meiotic crossing over within coding sequences
5) substrates for exon shuffling
6) signals for mRNA export from the nucleus and nonsense-mediated decay

12. Removal of nuclear (spliceosomal) introns is extremely complex process which requires up to 250 proteins and several small non-coding RNAs (U1, U2, U4, U5, U6)
Video

14. Reed R. Mechanisms of fidelity in pre-mRNA splicing. Curr. Opin
Reed R. Mechanisms of fidelity in pre-mRNA splicing. Curr. Opin. Cell Biol. 12, , 2000
There is a competition between SR-proteins and hnRNPs to build a net over pre-mRNA sequences. In cases of alternative splicing the structure of a pre-mRNA-protein complex and, thus the ultimate processing of pre-mRNA, depends on the concentrations of different SR-proteins and hnRNPs in the nucleus.

15. Group II introns in bacterial world F. Martinez-Abarca and N
Group II introns in bacterial world F. Martinez-Abarca and N. Toro Molecular Microbiology 2000, 38:

16. Group I intron
Adams et al. RNA (2004)

17. Evolutionarily distant species share only a portion of common introns
Animals and plants have no more than 50% of common intron positions in orthologous genes
Fedorov et al. PNAS 2002, 99:16128
Rogozin et al. Curr Biol 2003, 13:1512

18. Mapping intron positions onto a protein sequence

19. The best animal-plant intron match

20. Intron loss and gain during evolution

21. How to find intron loss or gain
Analysis of closely related species
(mouse, rat, human)
mouse
rat
homo + -
loss
gain
Case 1:
Case 2:

22. Intron loss in rodents

24. Results of intron comparison
Compared species
# genes
Total #
introns
# gain
# loss
Mouse vs
Rat
360
1,459
1 (Rat)
Human
1,560
10,020
5 (mouse)

25. Characterization of deleted introns
SPECIES
GENE NAME
LENGTH OF CORRESPONDING INTRON (nt)
Mouse
S-adenosylmethionine decarboxylase
291(Hs)
Ribosomal protein s18
81 (Hs)
Adaptor-related complex 1, mu 2 su
113(Hs); (? Rat)
Laminin alpha 5
107(Hs)
Transcription factor usf
245(Hs); 223(rat)
Rat
Tumor suppressor p53
393 (mouse)

26. Conclusions
A large-scale computational analysis of the human, D. melanogaster, C. elegans, and A. thaliana genomes has been performed. 147,796 human introns, 106,902 plant, 39,624 Drosophila and 6,021 C. elegans introns were examined. Different types of homologies between introns were found, but none showed evidence of simple intron transposition. No single case of homologous introns in non-homologous genes was detected. Thus we found no example of transposition of introns in the last 50 million years in humans, in 3 million years in Drosophila and C. elegans, or in 5 million years in Arabidopsis. Either new introns do not arise via transposition of other introns or intron transposition must have occurred so early in evolution that all traces of homology have been lost.

27. Genome Research 2003
For nearly 15 years, it has been widely believed that many introns were recently acquired by the genes of multicellular organisms. However, the mechanism of acquisition has yet to be described for a single animal intron. Here, we report a large-scale computational analysis of the human, Drosophila melanogaster, Caenorhabditis elegans, and Arabidopsis thaliana genomes. We divided 147,796 human intron sequences into batches of similar lengths and aligned them with each other. Different types of homologies between introns were found, but none showed evidence of simple intron transposition.

28. Alternative splicing
Production of multiple mRNA isoforms from the same gene often in a tissue-specific or development-stage-specific manner

29. Mutually exclusive exons
Isoform A
Isoform B

30. Optional exons
Isoform A
Isoform B

31. Alternative 5`-sites
Isoform A
Isoform B

32. Retained introns
Isoform A
Isoform B

33. Why alternative splicing is important ?
Half of human genes express multiple alternative mRNA isoforms,
many of which have important specific functions.
Alternative splicing alone increases the number of different polypeptides
in human cells by 2-3 fold above the number of human genes

34. Alternative splicing in Drosophila melanogaster
The study of sex-determination development in Drosophila involving the alternatively spliced Sex-lethal (Sxl), male-specific-lethal-2 (msl2), transformer (tra), and doublesex (dsx) genes led to the initial discovery of ESE (reviewed by Cline and Meyer 1996; MacDougall et al. 1995).

35. The best-known case of alternative splicing in invertebrates is the DSCAM gene of Drosophila. The estimated number of its alternative isoforms (~38,000) exceeds by almost three times the total number of fruit fly genes (Black, D.L., Protein diversity from alternative splicing: A challenge for bioinformatics and post-genome biology. Cell 103: ).

36. Alternative splicing in human
Defects in alternative splicing are associated with several human diseases:
1) frontotemporal dementia with parkinsonism,
2) amyotrophic lateral sclerosis,
3) paraneoplastic neurological disorders,
4) maybe some forms of schizophrenia,
Many types of cancer are linked to the altered patterns of alternative splicing. For instance, alternative isoforms of Bcl-2 family of apoptotic regulators have opposite apoptotic activities; frequently anti-apoptotic isoforms are over-expressed in lymphoma cells.
“Neurexin: three genes and 1001 products”
TIG 14:20-26, Missler M. and Sudhof T.C.

37. Comparative genomics Up to 60% of splicing isoforms are conserved between human and mouse
What about plants?

38. For computational biology the most efficient way to study alternative splicing is analysis of EST database

39. Detection of alternative splicing using EST database.
mRNA
ESTs

40. RNA-Seq Bioinformatics tools

41. This study, along with the following discussion, details the association of thousands of ncRNAs—snoRNA, miRNA, siRNA, piRNA and long ncRNA—within human introns. We propose that such an association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome.

42. It may be a “non-selfish” harmony between genes, introns, and ncRNAs
Expression
regulation
genes
ncRNA
symbiosis
Genes provide space for introns inside them
Introns provide space for ncRNAs inside them
ncRNAs provide expression regulation for genes

43. HOMEWORK #1 Which intron is it? Does it contain functional elements?
gtatctctgtatctttatgttgtatcaaacacatgatatttcacaacaagctgaaaagtaggattatgggcaatgccattgtcagcttgttgggcgatatggcaacccactatataatcctctcttaacagcattgggagtgttgtcaaaaggtttgacagacggttcggagaactgttgctctaggaggagctgagagttcaagtctctccatttcccaaaacttttttctcattcacgtggctggcttgtgtcctgttccactttgaatatatggctaccccatttgctttcaactgatgtatgatagttttgtcgctttatttcatttttatatattacaatattaccaatatctttgtcgttcaccag

44. OPTIONAL Homework assignment to earn extra credit
Why there is a difference in exon-intron structures of rat gaba-receptor gene from the paper and GenBank?

45. Missing introns in rat?
Alternative splicing generates a novel isoform of the rat metabotropic GABABR1 receptor.
Pfaff et al. Eur. J. Neurosci. 11: , 1999
Accession AF
Locus RNGABA1S1
exon 7
RAT paper
Exon 7=
ex 7a
ex 7b
intron
RAT genome

46. Error found in study of first ancient African genome
This week the authors issued a note explaining the mistake in their October 2015 Science paper on the genome of a 4,500-year-old man from Ethiopia1 — the first complete ancient human genome from Africa. The man was named after Mota Cave, where his remains were found. (Incompatible software)