1. W
3.7 kb
4.9 kb M A B W
448 bp M C W
2689 bp D M
2185 bp
Fig. S1. Verification with PCR amplification of the deletion mutants of pks1. (A) A 448-bp pks1 PCR product was obtained in the wild type, but no band was amplified for the Δpks1. (B) Up-hyg/Down-hyg, gave rise to a 3.7-kb fragment in Δpks1, and a 4.9-kb fragment in the wild type. (C) Up-hyg/Hyg (as) and Down-hyg/Hyg (s), which generated approximately 2689 bp and 2185 bp fragments, respectively, for the upstream and downstream of the integration site in the mutant Δpks1. W: wild type, M: marker ladder. The size of the bands was indicated.

2. A B
Fig. S2. Alignment for the sequence of the 3.7-kb PCR product that covered the deleted pks1 locus against hph gene (panel A) and pks1 (panel B). Solid lines are the identical parts of the compared sequences. This result verified the replacement at the pks1 locus occurred as anticipated. Alignment was conducted with the Software Omega 2.0 (Oxford University).

3. Δpks1
Δpks1-C
Fig. S3. Complemented strain Δpks1-C conidia restored to produce melanin in the culture (down), while the mutant strain Δpks1 conidia remained albino phenotype (upper left). Furthermore, the complement strain restored the morphology of the wild type conidia.

4. Δpks1-C Δpks1-C Δpks1 WT WT Δpks1A B
hph fragment
448 bp
Fig. S4 A&B. PCR confirmatins show that the wild-type copy of pks1 has been successfully introduced into the complemented strain Δpks1-C. A 8141-bp pks1 fragment covering the whole length pks1 including its ORF and 1-kb promoter region and 542-bp terminator region was transformed into Δpks1. Panel A: a 488-bp pks1 internal fragment was amplified with the pair of primers, Pks (s)/Pks (as), in the three complements (Δpks1-C) and the wild type strain (WT), while no band was obtained in Δpks1, confirming the complemented strain acquired the wild-type copy of pks1. Panel B: shows a 0.5-kb hph gene fragment was amplified in Δpks1, with the primers Hyg (s)/Hyg (as), but absent in the complements and the wild type. The results indicates that the 8141-bp pks1 fragment was integrated back to the pks1 locus and replaced the hygromycin resistance gene hph again.

5. Δpks1-C Δpks1-C Δpks1 WT WT Δpks1
8.1 kb
4.9 kb
7.2 kb
3.7 kb C D
Fig. S4 C & D (continued). PCR confirmation of the wild-type copy of pks1 in the complemented strain Δpks1-C . Panel C: The 8141-bp restoring pks1 fragment was amplified in the three complements (Δpks1-C) and the wild type strain (W), only a 7202-bp fragment was amplified in Δpks1. Panel D: PCR amplification with a same pair of primers used in Fig. S1B, Up-hyg/Down-hyg (Table 1), that were located outside of the deletion cassette (Fig. 2A), gave rise to a 3.7-kb fragment in Δpks1 and a 4.9-kb fragment in the complements and the wild type. This PCR results confirmed again the 8141-bp pks1 fragment restored the pks1 locus to the wild-type state.

6. Primers for the complement PKS
pkster-sen CCCGGAATTCAGAGGTGGGAAAAGCAGATG
pkspro-anti CCCGGAATTCGAACCAACACAAAGACCTGC
Fig. S4 E (continued). PCR products were sequenced to confirm the existence of the wild-type-copy pks1 in the complemented strain Δpks1-C .

7. Fig. S5. Δ pks2 Δ pks3 Δ pks4 A WT mutant 2102 bp 1664 bp 3042 bp

8. B.
Fig. S5. A. Verifications with PCR amplification of the deletion mutants of pks2, pks3, pks4. (A) Pks2-up/Hyg (as) and Pks2-down/Hyg (s), which generated approximately 2102 bp and 1664 bp fragments respectively, for the upstream and downstream of the integration site in the mutant Δpks2, but no band for the wild type. (B) Pks3-up/Hyg (as) and Pks3-down/Hyg (s), generating approximately 3042 bp and 2941 bp fragments respectively, for the upstream and downstream of the integration site in the mutant Δpks3, but no band for the wild type. (C) Pks4-up/Hyg (as) and Pks4-down/Hyg (s), which generated approximately 2562 bp and 2016 bp fragments respectively, for the upstream and downstream of the integration site in the mutant Δpks4, but no band for the wild type. W: wild type, M: marker ladder. The size of the bands was indicated. B. Disruption of 3 other PKS genes which are responsible for the biosynthesis of conidial yellow (E-value 0.0) showed no apparent phenotype.

9. 10mM mM mM WT
Δpks1
Δpks1 WT B A
Fig. S6. For the oxidative stress tolerance assay, conidia in suspension were inoculated onto MM with 10, 20, 30 mM H2O2 and incubated at 28 ℃ for 8 days. Colony diameter of each strain was measured. For each strain at each medium, three replicates were used. No alteration in sensitivity to oxidative stress was found for Δpks1 strains compared to WT, suggesting pks1 has no distinguishable effects on regulation of oxidative stress response.

10. Fig. S7. For the oxidative stress and other stresses tolerance assay, conidia in suspension (4 μl of 80 conidia/μl) of mutants and WT strain were inoculated onto MM with 0.5%, 1% Congo red and 0.01%, 0.1% SDS, grown at 28 ℃ for 8 days. Colony diameter of each strain was measured. For each strain at each medium, three replicates were used. Pks1 mutant showed no alteration in sensitivity to oxidative stress or other external stresses (Congo red or SDS) compared to the WT strain.