1. Comparative Analysis of the Expanding Streptomyces BC Cluster
Rusty Hartman, Claudia McCown, and Lee E. Hughes, Department of Biological Sciences, University of North Texas, Denton, TX
ABSTRACT
Methods were performed using the Streptomyces Phage Laboratory Manual (Lewis, Loesser-Casey, Temple, Hughes) with slight modifications.
Phage samples were sent to Pittsburgh Bacteriophage Institute at Pittsburgh, Pennsylvania to be sequenced, in order to be later annotated.
Software used during annotation and the procedures used to annotate the phages were taken from DNA Master Annotation Guide (Lawrence).
Five phages were isolated on Streptomyces venezuelae, and Raleigh was isolated on Streptomyces griseus.
METHODS
Students at the University of North Texas isolated several new members of the Streptomyces BC cluster, including 3 members of the new BC3 subcluster. A total of six BC phages were characterized and annotated: Picard and Mojorita (BC1); Raleigh (BC2); and Bioscum, PapayaSalad, and Ididsumtinwong (BC3). These phages were isolated from Texas soils between the years 2014 and 2015 on Streptomyces venezuelae ATCC with the exception of Raleigh. Raleigh was isolated on Streptomyces griseus ATCC from New Jersey soil. These phages have an average genome size of approximately 38,800 bp, with approximately 55 protein coding genes each. The only tRNA identified is in Bioscum. The average G+C content for all six phages is 72%, which closely mirrors G+C contents of S. venezuelae and S. griseus, which are both around 73%. Several additional analyses were performed on these phage isolates after completion of genome annotation. Bioscum was tested to see if lysogeny occurred on the host strain. A Bioscum lysogen was successfully isolated and tested against phages PapayaSalad and Mojorita. While PapayaSalad is potentially homoimmune to Bioscum, Mojorita was able to infect the lysogen. In host range testing, PapayaSalad was tested for infection on six different Streptomyces hosts. These tests showed negative results, thus the only known host for PapayaSalad is currently S. venezuelae. During host range testing of phage Mojorita on S. griseus ATCC 10137, a single plaque was noted on one of the dilution grids. While the original phage typically only infects S. venezuelae, the Mojorita variant from the spot test infects S. griseus with high efficiency. Work to sequence the variant is under way to further identify the mutation responsible for the change in host range. Additional bioinformatics research was also conducted on the phage PapayaSalad this year. This analysis identified a 376 bp gap between a reverse gene (gp32) and a forward gene (gp33) of PapayaSalad which contains a reverse promotor, a forward promotor, and a 22 base pair palindrome sequence. The purpose of this palindrome is currently unknown, but is of interest for further analysis. Through the research conducted in the UNT PHAGES courses this year, many new discoveries have been made about BC cluster phages. These discoveries have expanded not only the number of BC cluster phages, but also our knowledge of these genomes. These results have and will potentially lead to new research in the future in regards to Streptomyces phages.
RESULTS
Figure 4. Bioscum on Bioscum lysogen (left), PapayaSalad on Bioscum lysogen (middle), and Mojorita on Bioscum lysogen (Right).
Genome Size
39522
38496
40785
37380
38411
37817
Draft Gene # 55 56 52 53 54
tRNA 1
G+C %
72.6%
72.5%
71.8%
72.3%
72.4%
Picard
PapayaSalad
Ididsumtinwong
Mojorita
Raleigh
Bioscum
Figure 1. Plaque Picture of Bioscum showing typical plaque morphology for BC phages.
Figure 2. Electron Microscopy of PapayaSalad showing the size, shape, and characteristics that are similar to other BC phages.
Figure 6. Table comparing genomic size, draft gene number, number of tRNAs, and G+C percentages between each BC subclusters.
Figure 7. Depiction of the bioinformatics of PapayaSalad.
10.0 kb
8.0 kb
6.0 kb
5.0 kb
4.0 kb
3.0 kb
2.0 kb
1.5 kb
1.0 kb
0.5 kb
Ladder Uncut Haelll Kpnl Pmll Sacl Sfil Styl
Electron Microscopy showed that BC phages have siphoviridae morphology with a approximate capsid diameter of 60 nm and a tail length of 140 nm.
When tested for ability to infect Bioscum lysogen, Bioscum and PapayaSalad, tested negative, whereas Mojorita tested positive.
Host ranges performed on PapayaSalad tested negative for S. azeraus, S. albus, S. toxytricini, S. griseus, and S. griseus rhodocrous.
Bioscum, PapayaSalad, and Mojorita all were isolated on host containing Chymera prophage.
We potentially isolated a mutant of Mojorita that infects Streptomyces griseus.
Bioinformatics of PapayaSalad potentially identified two promotors and a palindrome sequence in a small region of its genome. The reverse promotor starts at bp and the forward promotor starts at bp. There is a 22 bp palindrome sequence (TATCTTTCACGCGTGAAAGATA) that has 100% match to itself. The palindrome sequence starts at bp, and begins to mirror itself at bp.
Bacteriophages make up the majority of the biological world, being the most diverse population to thrive on this planet. Streptomyces bacteria is known in the medical world for its vast range of antibiotic production. Streptomyces was initially chosen for bacteriophage research due to its unique characteristics regarding antibiotics. It is possible that one day, a phage will be isolated that could have antibiotic genes within its genome. The G+C percentages for the hosts used in this study, Streptomyces venezuelae and Streptomyces griseus, are about 73%. Since bacteriophages generally resemble their host, we would expect phage isolates to mirror this composition. The BC cluster of Streptomyces bacteriophages has recently been expanded to include several new BC1 phages as well as a whole new BC3 subcluster consisting of 3 phages. During the past year, at the University of North Texas, PHAGES students have accomplished research over these phages and ones like them in order to identify more unique characteristics.
Introduction
10.0 kb
8.0 kb
6.0 kb
5.0 kb
4.0 kb
3.0 kb
2.0 kb
1.5 kb
1.0 kb
0.5 kb
Figure 3. Bioscum (left) and Mojorita’s (right) Restriction Gel Analysis showing differences between BC3 and BC1 phages.
DISCUSSION
The GC content of Streptmomyces venezuelae is 73%. Since these phages had GC contents that were in this range, this provides evidence of why they infect this type of bacteria.
Bioscum and PapayaSalad appear to be in the same immunity group, whereas Mojorita is not in the same immunity group.
The attachment mechanism for BC phages could be specific to Streptomyces venezuelae, due to the lack of host range.
There is a potential characteristic that allows BC phages to be isolated with competition of prophage, Chymera.
In experimentation of Mojorita, we now potentially have two variations of the phage, Mojorita: one infecting S. griseus and one infecting S. venezuelae.
Bioinformatics of PapayaSalad showed an interesting promotor/palindrome region.
Subcluster BC1
Lewis, Lynn, Kathryn Loesser-Casey, Louise Temple, and Lee Hughes. Streptomyces Phage Laboratory Manual. Chevy Chase, MD: Science Education Alliance Howard Hughes Medical Institute. Web.
Lawrence, Jeffery G. Retchless, Adam. DNA Master Annotation Guide. Science Education Alliance and the Howard Hughes Medical Institute.
James G. Lamine, Randall J. DeJong, and Serita M. Nelesen. PhamDB: a web-based application for building Phamerator databases Bioinformatics. Published online Februarty 26, doi: /bioinformatics/btw106
REFERENCES
Subcluster BC3
Sponsored by Howard Hughes Medical Institute and Science Education Alliance.
Sonya R. Layton, Swapan Bhuiyan, Subhayu Nayek
Austin Sivoravong, Theresa Clifford, Allyson Adame, Cory Meyer, and Richard Hale
UNT Phages and 502 Class
ACKNOWLEDGMENTS
Subcluster BC2
Figure 5. Phamerator Map Comparing the genomes of Mojorita, Picard, Bioscum, Ididsumtinwong, PapayaSalad, and Raleigh (produced using PhamDB software, database of Streptomyces phage genomes only).