The Structure of DNA Notes

The Structure of DNA Notes
All life on earth uses a chemical called DNA to carry its genetic code or blueprint. In this lesson we be examining the structure of this unique molecule. {Point out the alligator’s eyes in the first picture.} By the way, can you make out what this is? *************************************************************** [The goal of this presentation is to introduce high school biology students to the chemical structure of DNA. It is meant to be presented in the classroom while accompanying the teacher’s lecture, under the control of the teacher.]

DNA DNA is often called the blueprint of life.
In simple terms, DNA contains the instructions for making proteins within the cell. Why is DNA called the blueprint of life?

Why do we study DNA? We study DNA for many reasons, e.g.,
its central importance to all life on Earth, medical benefits such as cures for diseases, better food crops. About better food crops, this area is controversial. There is a Dr. Charles Arntzen who is working on bioengineering foods with vaccines in them. People in poor countries could be immunized against diseases just by eating a banana, for instance.

Chromosomes and DNA Our genes are on our chromosomes.
Chromosomes are made up of a chemical called DNA. {Ask students where the chromosomes are in this picture. Or ask them where the DNA is. Remind them that the mitochondria also have DNA.}

The Shape of the Molecule
DNA is a very long polymer. The basic shape is like a twisted ladder or zipper. This is called a double helix. {Show students a model of the double helix. Explain what a spiral is and a helix is.}

The Double Helix Molecule
The DNA double helix has two strands twisted together. We will take apart the DNA molecule to see how it is put together. First, we will look at one strand.

One Strand of DNA The backbone of the molecule is alternating phosphates and deoxyribose sugar The teeth are nitrogenous bases. phosphate deoxyribose {Point to the 3-D mode, if you have one, to show the parts as you discuss them.} bases

Nucleotides O -P O O ATP One deoxyribose together with its phosphate and base make a nucleotide. O -P O O Nitrogenous base C O Phosphate {Ask students where they have seen a similar molecule before in this class. Answer: ATP Emphasize that nucleotides are the basic building blocks or units of a DNA molecule and that a single molecule has many millions of nucleotides.} C C C Deoxyribose ribose O

One Strand of DNA One strand of DNA is a polymer of nucleotides.
One strand of DNA has many millions of nucleotides. {Point to the 3-D mode, if you have one, to show the parts as you discuss them.}

Four nitrogenous bases
DNA has four different bases: Cytosine C Thymine T Adenine A Guanine G These four bases are abbreviated by using their respective first letters.

Two Kinds of Bases in DNA
Pyrimidines are single ring bases. Purines are double ring bases. N C O C C N C C N

Thymine and Cytosine are pyrimidines
Thymine and cytosine each have one ring of carbon and nitrogen atoms. C N O cytosine C N O thymine

Adenine and Guanine are purines
Adenine and guanine each have two rings of carbon and nitrogen atoms. C N O Guanine C N Adenine

Two Stranded DNA Remember, DNA has two strands that fit together something like a zipper. The teeth are the nitrogenous bases but why do they stick together? {Point to the 3-D model to show the parts as you discuss them.}

Hydrogen Bonds The bases attract each other because of hydrogen bonds.
Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. The bonds between cytosine and guanine are shown here with dotted lines C N O

Hydrogen Bonds, cont. C N O When making hydrogen bonds, cytosine always pairs up with guanine Adenine always pairs up with thymine Adenine is bonded to thymine here

Chargraff’s Rule: Adenine and Thymine always join together A T
Cytosine and Guanine always join together C G

DNA by the Numbers Each cell has about 2 m of DNA.
The average human has 75 trillion cells. The average human has enough DNA to go from the earth to the sun more than 400 times. DNA has a diameter of only m. The earth is 150 billion m or 93 million miles from the sun. If you unravel all the DNA in the chromosomes of one of your cells, it would stretch out 2 meters. If you did this to the DNA in all your cells, it would stretch from here to sun more than 400 hundred times!

DNA & RNA Notes Page 9

Bodies  Cells  DNA Bodies are made up of cells
All cells run on a set of instructions spelled out in DNA

DNA  Cells  Bodies How does DNA code for cells & bodies?
How are cells and bodies made from the instructions in DNA?

DNA  Proteins  Cells  Bodies
DNA has the information to build proteins genes proteins cells DNA gets all the glory, Proteins do all the work bodies

How do proteins do all the work?
proteins run living organisms enzymes control all chemical reactions in living organisms structure all living organisms are built out of proteins

Cell organization DNA DNA is in the nucleus
genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids (20)
made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information
Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA cytoplasm nucleus build proteins mRNA ribosome

From nucleus to cytoplasm
transcription DNA mRNA protein translation trait nucleus cytoplasm

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases Guanine Cytosine
Adenine Thymine T pairs with A C pairs with G double stranded double helix-shape RNA ribose sugar nitrogen bases Guanine Cytosine Adenine Uracil U pairs with A C pairs with G single stranded NO “T”

DNA & RNA Foldable Notebook Page 11
Get a piece of construction paper and coloring pencils. Fold the paper as instructed. An example is up front. On the outside flaps. Label one side DNA and one side RNA. On the inside flaps Draw the structure of DNA on one flap. Draw the structure of RNA on the other flap. On the inside middle List the bases of RNA & DNA. List the Sugar of RNA & DNA. Write a description of RNA & DNA.

Nucleotides Drawing & Questions Notebook Page 9
Front---Draw, Color, Label & Descriptions Page 282 Figure 11.1 A, B & C Back---Write questions & answers What are the 3 components of a nucleotide? (Deoxyribose/ribose) is the sugar of DNA. The four nitrogen bases of DNA are: adenine, cytosine, guanine, and (uracil/thymine). What is the difference in pyrimidines and purines?

DNA Replication Notes Notebook Page 11

This process is called DNA Replication.
DNA Replication Notes The DNA molecule’s most crucial task is to provide the information necessary to lead to the production of proteins. Must make exact copies Why? All cells need the same copy of DNA when they divide This process is called DNA Replication.

Steps of DNA Replication
Unzipping – Enzymes (DNA helicase) break apart the weak hydrogen bonds that hold the bases together in the middle of the strand. New nucleotides are added to each side of the original strand by the base pairing rule.

Steps of DNA Replication
3. Unzipping Process continues until 2 molecules of DNA are formed. Each has 1 original DNA strand and 1 new strand Called semi-conservative replication Some old DNA and some new DNA

Transcription Notes Notebook Page 11

Transcription First step to protein synthesis Making mRNA from DNA
DNA strand is the template (pattern) match bases U : A G : C Occurs in the Nucleus Enzyme RNA polymerase

Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

cytoplasm protein nucleus ribosome U C A G trait

How does mRNA code for proteins
mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA U C A G aa

Exit Ticket Name the first step to protein synthesis.
Where does transcription occur in the cell? Name the four bases found in RNA. Where in the cell is mRNA made? DNA has the code to make what organic molecule in the body? Name the three types of RNA and define the function of each.

Structure of DNA Notebook Page 10
Materials: Handout, Construction Paper, Glue, Scissors, & Coloring Pencils. Color before cutting! T=Red C=Yellow G=Green A=Blue Color all Phosphates a different Color Color all Sugars a different Color Place on the Construction Paper Before Gluing. Remember: A pairs with T. G pairs with C. Title your Page. Glue the Instruction Paragraph on the construction paper. Label the Phosphates & Sugars. Example is on the Board. No One should have the same DNA. Our DNA makes us all different!

Translation Notes

How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code For ALL life! Code has duplicates Start codon
strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids?
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

mRNA to protein = Translation
The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

From gene to protein DNA mRNA protein trait tRNA transcription
aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

cytoplasm protein transcription translation nucleus trait

From gene to protein protein transcription translation

Steps to Protein Synthesis
DNA is transcribed into mRNA in the nucleus (Transcription). mRNA travels to a ribosome where its codons are decoded into amino acids using a codon chart. (Translation) Amino acids are assembled into polypeptide chains, or proteins.

Whoops! See what happens when your genes don’t work right!
Any Questions??

Attach the codon chart worksheet in your notebook on page ______

Exit Ticket Three nucleotides of mRNA that code for an amino acid.
Name the second step to protein synthesis. Where does translation occur in the cell? What amino acid does the codon AGG code for? What are the building blocks of protein?

Mutations Notes Changes to DNA

Mutations Changes to DNA are called mutations change the DNA
changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

Does this change the sentence?
Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

Does this change the sentence?
Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

Does this change the protein?
Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

Does this change the protein?
Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

Cystic fibrosis Broken salt channel in cells
strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.

mucus & bacteria build up = lung infections & damage
Effect on Lungs Salt channel transports salt through protein channel out of cell Osmosis problems! normal lungs airway salt salt channel normal mucus H2O cells lining lungs cystic fibrosis salt  thick mucus In people without cystic fibrosis, working cystic fibrosis proteins allow salt (chloride) to enter the air space and water follows by osmosis. The mucus layer is dilute and not very sticky. In people with cystic fibrosis, non-working cystic fibrosis proteins mean no salt (chloride) enters the air space and water doesn't either. The mucus layer is concentrated and very sticky. People with cystic fibrosis have lung problems because: Proteins for diffusion of salt into the airways don't work. (less diffusion) Less salt in the airways means less water in the airways. (less osmosis) Less water in the airways means mucus layer is very sticky (viscous). Sticky mucus cannot be easily moved to clear particles from the lungs. Sticky mucus traps bacteria and causes more lung infections. Therefore, because of less diffusion of salt and less osmosis of water, people with cystic fibrosis have too much sticky mucus in the airways of their lungs and get lots of lung infections. Thus, they are sick a lot. H2O mucus & bacteria build up = lung infections & damage

Deletion leads to Cystic fibrosis
Loss of one amino acid!

Not to ask questions is a mutation!

Exit Ticket A change in the nucleotide sequence of DNA is known as what? Name the two types of mutations and give an example of each? Which type of mutation causes the greatest change in the protein made? Additions and deletions are what type of mutation? (True/False) Changes to DNA can cause changes in the DNA, the mRNA, the protein and the trait expressed.

DNA Technology Applied biology that involves the manipulation of DNA for the purpose of engineering new genes Examples: gene therapy, DNA fingerprinting, cloning, GMOs

Gel Electrophoresis DNA can be separated based on size and charge
(restriction enzymes) DNA is placed in a gel and electricity runs through the gel Smaller fragments move farther and faster

DNA Fingerprinting DNA technology in crime scene investigation
Produced by gel electrophoresis Used in suspect identification DNA fingerprints are unique to individuals Separation of DNA pieces through an electrically charged field

Restriction Enzymes Enzymes break materials down
Used to cut DNA into pieces Smaller fragments travel farther in the gel Each person’s DNA has the same fragmentation pattern May also be used to catalogue endangered species Restriction Enzymes

TRANSFORMATION Genetic engineering can be accomplished through transformation. Transformation is when a cell takes in DNA from outside the cell. This DNA becomes part of the cell’s DNA. This can be accomplished with the help of bacteria.

Steps of Bacterial Transformation
1-Remove the plasmid from the bacterium.

2-Isolate the gene of interest. A gene of interest is a piece of DNA that codes for a protein we want more of

3-Open the plasmid by cutting it with a restriction enzyme

4-Insert the gene of interest

5-Insert the plasmid with recombinant DNA into a new bacterium. Recombinant DNA: DNA produced by combining DNA from different organisms

6-The bacteria reproduces itself and the plasmid. All products express the inserted gene

Cloning Clone- a member of a group of genetically identical cells
May be produced by asexual reproduction (mitosis)

Human Genome Project 13 year project involving human DNA
Sequenced 30,000 genes found in human genetic code Mapped every gene in the body Useful in determining whether individuals may carry genes for genetic conditions and in developing gene therapy Sequenced base pairs Human Genome Project

Gene Therapy Used to help patients with certain genetic disorders
Treats or manages genetic disorders Replaces defective genes with functional genes Examples: Severe Combined Immunodeficiency (SCID) patients lack a portion of a gene controlling the immune system Cystic Fibrosis: patients have a defective gene causing excess production of mucus in the lungs which lead to severe infections and pain Benefits: Both treated successfully with gene therapy

Transgenic Engineering
Moving DNA from 1 species to another Example: Producing human insulin from bacteria How it works: The gene for insulin production is inserted into a bacterial cell (DNA plasmid) Bacteria can then produce insulin

Genetically Engineered/Modified Organisms
Purposes: Study diseases, transplants, agricultural purpose, and pharmaceutical production Ex: Tomatoes with increased nutritional value

Agricultural Application
Plant genes altered Provide hybrid products and resistance Benefit: better taste and more growing success Bioluminescent organisms, malaria resistant mosquitos, and transgenic mice for lab studies

The Structure of DNA Notes

Similar presentations

Presentation on theme: "The Structure of DNA Notes"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

The Structure of DNA Notes

Similar presentations

Presentation on theme: "The Structure of DNA Notes"— Presentation transcript:

Similar presentations

About project

Feedback