1. Protein Synthesis (DNA Transcription and Translation)
Sections 12.3 & 12.4
Pages

2. What is a Gene?
Pg. 336
Gene: a segment of DNA that codes for a specific protein
The Central Dogma of Biology:
DNA codes for RNA and RNA makes protein (the synthesis of)
Transcription ^
Translation ^

3. One gene codes for one polypeptide →
Pg. 336
One gene codes for one polypeptide →
polypeptide - a chain of bonded amino acids
A polypeptide forms a protein

4. Let’s make some observations about RNA’s structure …

5. RNA RNA stands for: RNA is found in the: Ribonucleic acid
Pg. 336
RNA
RNA stands for:
Ribonucleic acid
RNA is found in the:
Nucleus and Cytoplasm

6. RNA Structure Made up of nucleotides (just like DNA)
Pg. 336
Made up of nucleotides (just like DNA)
Each nucleotide consists of a:
Sugar (ribose)
Phosphate
Nitrogen Base
Single Stranded!
Many different shapes and lengths

7. RNA’s Nitrogen Bases Adenine (A) Cytosine (C) Guanine (G) Uracil (U)
Pg. 336
RNA’s Nitrogen Bases
Adenine (A)
Cytosine (C)
Guanine (G)
Uracil (U)

8. There are 3 types of RNA: Page. 336
Pg. 336
There are 3 types of RNA:
Messenger RNA (mRNA) – a long strand of RNA nucleotides that are formed complementary to one strand of DNA.
Carries genetic information from DNA in the nucleus to Ribosome in the cytoplasm.
Page. 336

9. Pg. 336
2. Ribosomal RNA (rRNA) – associates with a protein to form the ribosome

10. Pg. 336
3. Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.

14. Do Now Fill in chart below:
DNA
RNA
Structure
Sugar
Base
Example strand: Complementary:
TACGA

15. Do Now What are the three types of RNA? What is the purpose of each?
What is the Central Dogma?

16. So how do we make a protein?
Pg. 336
So how do we make a protein?
Step 1: a segment of DNA needs to be copied into an RNA strand, known as transcription.
STEP 1: Transcription

17. Transcription Location: Nucleus First step in making a protein
Pg. 337
Location: Nucleus
First step in making a protein
Process of taking one gene (DNA) and converting into a mRNA strand

18. Steps to Transcription
1. An enzyme (RNA polymerase) attaches to the promoter (start signal region) of a gene and unwinds the DNA

19. Steps to Transcription (Cont.)
2. One strand acts as a template.

20. Steps to Transcription (Cont.)
3. A mRNA copy is made from the DNA template strand by RNA polymerase
4. mRNA is made until it reaches the termination (stop signal) sequence
5. mRNA is released and the two strands of DNA rejoin.

22. Template vs. Non Template Strand

24. Transcription animations and Videos

25. Transcribe this DNA to mRNA
Template Strand

26. Label the Transcription diagram
Template Strand
B. Non-Template Strand
C. RNA Nucleotides
D. mRNA
E. RNA Polymerase

27. mRNA Processing
Pg. 337
Pre-mRNA – the original sequence of RNA created during transcription
mRNA reaches the ribosomes

28. RNA Processing cont... In Eukaryotes only Introns- non-coded sections
(a.k.a “Junk” DNA)
Exons- codes for a protein

29. RNA Processing cont...
Before RNA leaves the nucleus, introns are removed and exons are spliced together
A 5’cap and poly A tail are added to ends of
the sequence
mRNA leaves the nucleus through the nuclear pores

31. Why is it necessary to add the poly A tail and 5’ cap?
Keeps mRNA from degradation, and helps mRNA bind to ribosome.

33. Let’s try an example… Original DNA Sequence (DNA):
5’ GTACTACATGCTATGCAT 3’
Transcribe it
3’ CAUGAUGUACGAUACGUA 5’
Add the 5’ cap:
3’ CAUGAUGUACGAUACGUA ’
cap

34. Finish the job! Add a poly A tail onto the 3’ end
Remove the introns “UGUA” and “AUAC”:
3’ CAUGAUGUACGAUACGUA ’
cap
3’ CAUGACGGUA ’
cap
Add a poly A tail onto the 3’ end
3’AAAAACAUGACGGUA ’
cap

35. Do Now 5’ T A C C G G T A C A G T G 3’ 3’ A T G G C C A T G T C A C 5’
What is the purpose of transcription?
Where does it start and end?
What enzyme is involved?
Perform transcription below: (Template)
5’ T A C C G G T A C A G T G 3’
3’ A T G G C C A T G T C A C 5’
What direction did transcription occur?

36. Try another problem! Complete transcription and RNA processing for the following:
DNA Strand of non-template strand:
5’ ATCGGTAGAGTATTTACAGATA 3’
Remove introns:
CGGUA UUACAG

37. Converting RNA into a Protein
Pg. 338
Converting RNA into a Protein
Step 2: The RNA strand is decoded and produces a specific protein, known as translation.
STEP 2: Translation

38. Proteins -made of 20 different Amino Acids - Amino Acids bond to form
polypeptide chains

39. How do amino acids form these peptide chains?
Peptide Bonds – Link each amino acids
together to form proteins

40. Protein
Structure

41. Do Now What bonds connect those subunits? Where are proteins made?
What subunits are proteins made of?
What bonds connect those subunits?
Where are proteins made?
What are the 3 mains parts to protein synthesis (making of proteins)?

42. Translation
Pg. 338
mRNA goes to the ribosomes in the cytoplasm or the RoughER and produces proteins
Three main stages:
Initiation
Elongation
Termination

43. Pg. 339
Pg. 339

44. Ribosome Two subunits to the ribosome
Large AND small
3 sites on the ribosome (A, P, E )
A: tRNA binding site
P: polypeptide bonding site
E: exit site

45. Steps to Translation Initiation: Pg. 338
1. mRNA binds to a ribosome in the cytoplasm
2. The two ribosomal subunits come together at the 5’ end of the mRNA.
3. Ribosome will find the start Codon (AUG) and the first tRNA molecule will attach
This is the only tRNA that will attach to the P site (and skip the A site)
The first amino acid is always methionine.

46. What is a codon?
Pg. 338
Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

47. Start and Stop Codons Start Codon - AUG Stop Codons - UGA, UAG, & UAA
Pg. 338
Start Codon - AUG
Stop Codons - UGA, UAG, & UAA

50. Think-Pair-Share
The mRNA sequence reads the following codons: What amino acids do they stand for?
AUG
GGA
GAG
CAA

51. Do Now: DNA Template: 3’ CGACTACCAGAGACATTACAATCATTAAACG 5’
Transcribe:
RNA Processing:
Intron: AAUG
Translate:

52. tRNA tRNA has an anticodon that matches the codon on the mRNA strand
Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

53. Steps to Translation (Cont.)
Pg. 338
Elongation:
4. Amino acids attached to a tRNA molecules are brought over to the mRNA, and load in at the A site of the ribosome.
5. A polypeptide bond is formed between the amino acids in the P and A sites of ribosome.
6. Ribosome shifts over, opening up the A site for a new tRNA molecule.
7. tRNA in the E site leaves, leaving behind the amino acid.

54. Steps to Translation (Cont.)
Pg. 338
Termination:
8.Translation is terminated when a stop codon is reached. There are three different stop codons UGA, UAA, UAG.
9. The release factor recognizes the stop codon, attaches to the mRNA strand in the A site of ribosome, and releases the polypeptide strand. All the factors break apart and can be reused again.

56. Translation Animations
Video 1
Video 2

57. Think – Pair - Share
Find the amino acid sequence for the following mRNA sequence (translation)
AUGCGACGAAUUUAA

58. Do Now
Conduct transcription and translation (remember start and stop codons!)
DNA: 3’ TTTTATACTGAGGGTTAACTCGT 5’
mRNA:
tRNA:
AA:

59. Challenge Question
Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA).
Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop
What do you notice about your DNA sequences?

60. Do Now: 1. What is lactase persistence? 2. Who is lactase persistent? 3. Why is lactase persistence beneficial? 4. Explain WHY most people are lactase persistent.

61. Mistakes in DNA Cell make mistakes in replication, and transcription
Pg. 345
Mistakes in DNA
Cell make mistakes in replication, and transcription
Most often these mistakes are fixed
When these mistakes aren’t fixed, it causes a mutation.
A permanent change that occurs in a cell’s DNA is called a mutation.

62. Point Mutation Pg. 346 Substitution: A change in just one base pair
Missense Mutation: amino acid is change
Nonsense Mutation: amino acid is changed to a stop codon
Cause translation to terminate early.
Usually leads to proteins that can’t function normally.
Silent Mutation: change codes for same amino acid and cause no change in protein produced.

63. Frameshift Mutations
Pg. 346
Causes the reading frame to shift to the left or right
Insertion: Addition of a nucleotide
Deletion: Removal of a nucleotide

65. ACGAAATACAGACATATT Decide what type of mutation occurred:
ACGAAATACATACATATT
ACGAAATACAGAATATT
ACGAAATACAGGACATATT
ACGAAATACAGTCATATT

66. Causes of Mutations Mutations can happen spontaneously
Mutagens: Certain chemicals or radiation that can cause DNA damage
Causes bases to mispair and bond with the wrong base
High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.
Pg. 348

67. Sex Cell vs. Somatic Cell Mutations
Pg. 349
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells (gamete cells) are passed on to the organism’s offspring and will be present in every cell of the offspring

68. Chromosomal Mutations
Pg. 347
Inversion: Piece of chromosome can be broken off, duplicated, or moved to another chromosome

69. Sickle Cell Anemia
What type of mutation?

70. Mutation Videos
Video 1
Video 2
Video 3