Download presentation
Presentation is loading. Please wait.
1
Patient & tumor characteristics (n=39)
The influence of serum vitamin D and receptor expression in colorectal cancer (CRC) Paluri R, M.D.1, Desmond R, Ph.D.3, Putcha K, Ph.D.2, Jadhav T, Ph.D.2, Manne U, Ph.D.2, Posey J, M.D.1 1Dept. of Medicine, Division of Hematology and Oncology; 2Dept. of Pathology; 3Dept. of Biostatistics, University of Alabama at Birmingham, Birmingham, AL Objectives Patient & tumor characteristics (n=39) Results To determine vitamin D levels in patients with CRC in association with skin color and tumor stage. To validate our previous retrospective study showing that VDR expression is low in tumor tissues. To assess the relationship of vitamin D levels with ethnicity and tumor stage. VDR expression N (%) Sex Male (67) Female (33) Race Caucasian (54) African American (46) AJCC Stage I (3) II (38) III (36) IV (18) Tumor location Proximal (36) Distal (54) Rectum (10) Fitzpatrick score I & II (40) III, IV, & V (60) Vitamin D level <20 ng/ml (33) >20 ng /ml (67) Background Loss of vitamin D receptor (VDR) expression in human colorectal tissue has been implicated in the development of colorectal cancer (CRC). Previously, we retrospectively assessed vitamin D receptor (VDR) levels in 98 CRC tumor tissues and noted a variation of expression with tumor stage (GI ASCO 2009 abs # 371) The impact of vitamin D levels and vitamin D receptor activation in the development and progression of CRC has been suggested in previous trials This study seeks to characterize vitamin D levels in patients presenting with the diagnosis of CRC to correlate with cancer stage, skin type and other clinical variables. VDR vs STAGE Patients and Methods Fitzpatrick scale We prospectively evaluated 39 cases of CRCs newly diagnosed CRC’s during 3 consecutive summers and assessed demographics, pathological characteristics and clinical outcomes. Skin color was determined by the Fitzpatrick typing scale. At the time of enrollment, vitamin D levels were assessed, and a twenty-point lifestyle assessment questionnaire was administered. Tumor and corresponding normal tissues are being evaluated to identify the patterns of VDR expression Inclusion criteria: any patient above the age of 19 diagnosed with stage II-IV CRC prior to completing any planned stage appropriate therapy We also analyzed 16 CRCs and their adjacent normal tissues for the expression of VDR at the mRNA level by the quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) method. The expression levels were correlated with clinico-pathological features The PCR reactions were performed using an i-Cycler real-time PCR system (Bio-Rad) at 95°C for an initial denaturation followed by 45 cycles of 15 sec denaturation at 95°C, annealing at 60°C for 30 sec and extension at 70°C. Conclusions No correlation or association was found between serum vitamin D levels at the time of diagnosis (continuous and categorical) and VDR expression, race, or stage. The skin type (Fitzpatrick score) did not correlate with vitamin D levels, expression pattern, or stage at diagnosis. VDR expression is reduced significantly in CRC tissue relative to adjacent normal tissue. There is inverse relation between VDR expression and tumor stage (0.58 vs 0.51; p=0.4) These findings need to be validated in a larger sample set. Gene Primer Sequence Annealing VDR S 5’TTGCCATACTGCTGGACGC3’ A 5’GGCTCCCTCCACCATCATT3’ 60ºC Β-Actin S 5’AAAGTGCAAAGAACACGGCTAAG3’ A 5’TAAGTAGGCGCACAGTAGGTCTG3’
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.