Download presentation
Presentation is loading. Please wait.
Published byGwenda Booth Modified over 8 years ago
1
The Origin and Evolution of SARS Dept. of Microbiology, Faculty of Medicine, The University of Hong Kong The First Affiliated Hospital, Guangzhou Med. College Shenzhen C.D.C. Guangdong Province NIAID, Grant A195357 SARS FUNDS, Univ. of Hong Kong HKU, HK SAR, P.R. China; Sept 30, 2003 Yi Guan
2
Hypothetical Birthplace of SARS HKU, HK SAR, P.R. China; Sept 30, 2003
3
Hong Kong 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province
4
Hong Kong 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province The First SARS case was recognized on Nov. 16, 2002
5
Hong Kong 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province On Dec 17, 2002, SARS case was observed in the second city. 11 cases were recorded, 8 of them are medical staff
6
Hong Kong 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province The first SARS case in Zhongshan was reported on Dec. 26, 2002. Total 28 cases were clinically recognized. 13 of them are medical staff who had direct contact history with SARS patients.
7
HKU, HK SAR, P.R. China; Sept 30, 2003
8
Investigation Conclusion 1. Outbreak of atypical pneumonia (unidentified infectious agent, most likely viral infection) 2. Infectious Disease, with family and hospital clustered (incubation about 4 days, 1-11days) 3. Documented Diagnosis definition, Treatment and Prevention principles 4. Suggest to set up case report system Jan. 21, 2003 Zhong-Shan outbreak HKU, HK SAR, P.R. China; Sept 30, 2003
9
Hong Kong 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province The first community SARS case in Guangzhou was reported on Jan.31, 2003.
10
Visited Zhongshan and got onset there Jan 31, 03: admitted to The 2nd Affiliate Hospital at the afternoon, 30 medical staffs infected Feb 1, 03 - Feb 8, 03: transferred into The 3rd Affiliated Hospital, within those 8 days, 26 medical staffs got infected. Feb 8, 03: transferred into Guangzhou Infectious Disease Hospital. Family members and relatives of the patient also got infected (19). The First “Super-Infectious” case--- >100 cases HKU, HK SAR, P.R. China; Sept 30, 2003
11
Nov 16, 02 - Feb 9, 03: 305 SARS cases reported, 5 people were killed by the disease in Guangdong City Guangzhou Zhongshan Foshan Jiangmen Heyuen Shenzhen Total No. of case 226 28 19 15 11 6 305 Outbreak time Jan. 31, 2003 Dec. 26, 2002 Nov. 16, 2002 Nil Dec. 17, 2002 Nil HKU, HK SAR, P.R. China; Sept 30, 2003
12
Peak time of outbreak is on Feb. 9, 50 cases/day Feb. 12, 0330 new cases Feb. 19, 035 new cases No. of reported cases of Guangdong HKU, HK SAR, P.R. China; Sept 30, 2003
13
HKU started to initiate the investigation in Guangdong as early as on Feb 11, 03. One Big Question: Whether H5N1 bird flu get into humans, like 1997 incident? On Feb 12, 03, we got 18 patients’ samples On Feb 18, 03, we got 22 patients’ samples HKU, HK SAR, P.R. China; Sept 30, 2003
14
The major efforts were focused on to isolate H5N1 influenza virus We did isolate H5N1 influenza virus from Hong Kong family, and one from Guangzhou atypical pneumonia case We failed to isolate coronavirus earlier, but do benefit to the coming investigation in HK, i.e. our response system started to run before the case got into HK (setting up a lab in Guangzhou) Preliminary results
15
Isolation of coronavirus by FrHK4 cell cultures GZ43GZ50GZ60 HKU, HK SAR, P.R. China; Sept 30, 2003 Nurse Clerk Doctor
16
AC BD HKU, HK SAR, P.R. China; Sept 30, 2003
17
HKU39849 TOR2 HKU-66078 Urbani SIN2677 CUHK-Su10 HKU-65806 HKU-36871 BJ01 CUHK-W1 GZ50 GZ01 GZ60 GZ43 94 60 99 66 86 0.0005 HKU, HK SAR, P.R. China; Sept 30, 2003
18
B C D A C
19
Serological test for pair sera from patients with SARS 19 Total 4 1, I, II, IV < 4 folds +++++++ 4 4, 18, 32, III > 4 folds +++++ 11 21, 22, 23, 24, 26, 27, 28, 30, 31, 34, V > 4 folds ++++- Total Sample number Titer increase 2 nd sera1 st sera HKU, HK SAR, P.R. China; Sept 30, 2003
20
Where the SARS-Cov came from, Or how it was derived from? What we know, what we don ’ t know and, what studies are needed. Questions????? HKU, HK SAR, P.R. China; Sept 30, 2003
21
10 NIDOV IBV1 IBV2 TGEV 229E PEDV CUHK HK36 GZ43 GZ50 CAN CDC-USA HK39 BOV1 BOV2 MHV3 MHV1 MHV2 G3 G1 G2 SARS G4? HKU, HK SAR, P.R. China; Sept 30, 2003
22
l Several observations support the hypothesis of a wild animal reservoir – cases began independently in at least 5 different municipalities – early cases more likely to report living near agricultural market – 39% (9/23) of early cases were food handlers with likely animals contact Observation HKU, HK SAR, P.R. China; Sept 30, 2003
23
Himalayan palm civet (Paguma larvata) Hog-badger (Arctonyx collaris) Beaver (Castor fiber) Chinese Ferret-Badger (Melogale moschata) Raccoon-dog (Nyctereutes procyonoides) Chinese muntjac (Muntiacus reevesi) Chinese Hare (Lepus sinensis) Domestic cat (Felis catus) Eight species of wild and domestic animals were sampled in a live-animal market of Shenzhen on May 7, 03 HKU, HK SAR, P.R. China; Sept 30, 2003
24
Animals Human Sampling (nasal, rectal swabs, blood) RT-PCR diagnostic test Virus isolation and identification Sequencing viral genome Sequence comparison Phylogenetic analysis Blood Neutralizing antibody detection Methods Western Blot Assay HKU, HK SAR, P.R. China; Sept 30, 2003
25
Himalayan palm civet Raccoon-dog Six civets sampled, 4 out of them were PCR positive and 4 viruses were isolated One animal was PCR positive and 1 virus was isolated HKU, HK SAR, P.R. China; Sept 30, 2003
26
EM Photo of SCoV-like viruses HKU, HK SAR, P.R. China; Sept 30, 2003
27
1 kb 5 kb10 kb 25 kb 20 kb15 kb 30 kb ORF1a ORF1b S M E N B 27700 bp 27900 bp 27800 bp28100 bp 28000 bp 28200 bp Human Animal ORF 9 ORF 10 ORF 11 N ORF 13 ORF 9 CCTACTGGTTACCAACCTGAATGGAATAT ORF 10´ N ORF 13 Genome difference between animal and human SARS-Cov Deletion of human virus HKU, HK SAR, P.R. China; Sept 30, 2003
29
MHV 100 nucleotide SZ1 SZ13 SZ16 SZ3 GZ50 CUHK-W1 HKU36871 HKU39848 HKU66078 HKU65806 Urbani Tor2 GZ01 GZ60 GZ43 Animal Human Phylogenetic analysis of S gene of human and animal SARS viruses HKU, HK SAR, P.R. China; Sept 30, 2003
30
Detection of antibodies against recombinant nucleocapsid protein of SCoV in animal sera by Western Blot Assay HKU, HK SAR, P.R. China; Sept 30, 2003
31
Antibody detection from people working at the market HKU, HK SAR, P.R. China; Sept 30, 2003
32
Summary 1. SCoV-like viruses are prevalent in different types of wild animals in the retail market. 2. These animals together mankind forming a new ecosystem. 3. SARS is zoonosis. HKU, HK SAR, P.R. China; Sept 30, 2003
33
Need for further animal research l To control SARS we must understand the natural history of the virus l Field and laboratory studies are needed to determine the possible range of animal reservoirs, if there are amplification hosts and how the virus spills over to humans l Control strategies must focus on human and animal populations to be effective HKU, HK SAR, P.R. China; Sept 30, 2003
34
Acknowledgements 1. NIAID, Grant A195357 2. Ministry of Health, China Government 3. Guangdong Government 4. Guangdong CDC 5. The First Affiliated Hospital, Guangzhou Medical College 6. Department of Health, Shenzhen Government 7. Shenzhen CDC 8. Department of Microbiology, HKU HKU, HK SAR, P.R. China; Sept 30, 2003
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.