1. Gene Technologies and Human Applications

2. 15.1 The Human Genome Genomics: The study of entire genomes, especially by using technology to compare genes within and between species Sequencing genomes is a major part of Genomics Sequencing is to identify every DNA base pair that makes up each genome.

3. The Human Genome Findings Humans have few genes Scientists expected to find over 120,000 genes but only found about 25,000 Most human DNA is noncoding Less than 2% of human DNA seems to code for proteins Many human genes are identical to those of other species All humans are genetically close 99.9% of all human DNA is identical

4. Applications in Human Genetics Gene technologies allow us to find genes, copy them, turn them on or off, and even move them between organisms. A major part of gene technologies is genetic engineering. Genetic Engineering: The deliberate alteration of the genetic material of an organism Example: The human gene for insulin has been inserted into bacteria in order to produce insulin.

5. ATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCC GTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACG ATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGC GTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACAT GCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGT ACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATT AGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGT ACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATG CCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTAC GATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAG CGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTAC ATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCC GTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACG ATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGC GTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACAT GCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGT ACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATT AGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGT ACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATG CCGTACGATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTAC GATTAGCGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAG CGTACATGCCGTACGATTAGCGTACATGCCGTACGATTAGCGTAC

6. Vaccines Vaccines are used to prevent viral diseases but can be dangerous because they are made from disease causing agents By using genetic engineering, these vaccines can be more carefully designed and become less dangerous Genetically engineered vaccines have prevented some diseases that weren’t preventable before Vaccines contain a combination of weakened or dead viruses, and the antibodies used to fight that virus.

7. Treating Disease Many drug companies are now genetically engineering organisms to produce specific proteins for human use. Gene Therapy: Inserting a functional “replacement” gene into a person’s cells by using a genetically engineered virus. Gene therapy has had limited success because the human body has many protections against the invasion and genetic change that viruses cause.

8. 15.2 Gene Technologies in Our Lives Gene Technologies include a wide range of procedures that analyze, decode or manipulate genes from organisms Genetic Engineering is the deliberate alteration of the genetic material of an organism This process often involves inserting copies of a gene from one organism into another DNA that has been recombined by genetic engineering is called recombinant DNA. Organisms with recombinant DNA can be called recombinant, transgenic or genetically modified organisms (GMOs)

9. Everyday Applications Food Crops Most corn or soybean products sold in U.S. grocery stores are made from GMOs Livestock Livestock are engineered to grow faster, larger or have more muscle and less fat Medical Treatment Many medical conditions can be treated (example: diabetes) Basic Research Tools Using genes to find other genes by “glowing”

11. Salmon

14. DNA Fingerprinting Each person (other than identical twins) has some unique parts of their DNA sequence (that.1%) Samples can be compared to see if they are identical or related through ancestry In order to compare samples, DNA samples are cut, sorted and “tagged” to produce a pattern of banding This pattern of banding is called a DNA fingerprint.

17. Crime Scene Which sample is the victims? Was suspect 1 or 2 at the crime scene?

19. Paternity

20. Cloning Cloning and stem cell techniques are used in research on animal development and have potential for treating certain diseases A clone is an organism or piece of genetic material that is genetically identical to one that was preexisting Dolly, a cloned sheep, was born in 1997. Dolly was the first successful clone produced from the nucleus of an adult somatic (or body) cell.

21. How Was Dolly Cloned?

22. Problems With Cloning Although scientists have successfully cloned many species of animals, only a few of the cloned offspring have survived for long. In some cases, the fetuses have grown beyond normal size and many fail to develop normally with age. Because of these problems and because of ethical issues, efforts to clone humans have been made illegal in many countries.

23. Genomic Imprinting Some problems with cloning may be related to the ways that egg and sperm cells normally develop. Chemicals in the reproductive system turn “on” or “off” certain genes in the developing gametes. These genes later affect the development from embryo to adult. This effect is called genomic imprinting and may be altered when animals are cloned in a lab. Different genes may be activated early on, and the remaining development may be altered.

24. Stem Cells Stem Cell: A cell that can continuously divide and differentiate into various tissues. Some stem cells have more potential to differentiate than others Totipotent cells can give rise to any cell or tissue type. Pluripotent cells can give rise to any cell or tissue type except germ cells (cells that give rise to gametes) Multipotent cells can give rise to just a few different cell types

25. Stem Cells

26. Issues With Stem Cell Research The first major source of human embryos for stem cell research was fertility clinics. These clinics help people have children by uniting people’s gametes and culturing embryos in a lab. In some cases, parents give permission to use extra embryos for research, but the use of human embryos poses ethical issues. There is a large, ongoing debate about whether federal funds should be used for this kind of research.

27. Cord Blood Bank It is becoming more popular to take the blood from the umbilical cord, freeze it and store it in a cord blood bank. This is where many stem cells can be found These stem cells can be used in the future to help treat many genetic linked diseases such as Type 1 Diabetes and various amounts of cardiovascular problems. Recent research has shown that sometimes, these stem cells, when injected into the blood stream, and make their way up to the brain, and help resolve mobility issues or issues in patients or just had a stroke.

28. Stem Cells From SCNT Somatic-cell nuclear transfer is a technique of cell cloning where the nucleus of an egg cell is replaced with the nucleus of an adult cell. This technique is used to create “artificial” embryos. Although some believe harvesting stem cells from embryos, many believe this is a more acceptable and ethical technique because the embryo made through SCNT does not have true parents.

29. 15.3 Gene Technologies in Detail The basic tools of DNA manipulation rely on the chemical nature of genetic material and are adapted from natural processes that have been discovered in cells. Restriction enzymes, polymorphisms, gel electrophoresis, denaturation and hybridization For example, the first GMOs were made by using plasmids and enzymes that are naturally present in some bacterial cells

30. Restriction Enzymes Restriction enzyme: an enzyme that cuts double- stranded DNA into fragments by recognizing specific nucleotide sequences and cutting the DNA at those sequences (called a restriction site). These enzymes are useful in two ways: Different enzymes recognize different sequences, so the enzymes can be used to cup up a DNA sample in specific ways. The cuts of most restriction sites create a “sticky end”. This sticky end has a few bases that are unpaired, but are usually complimentary to the other sticky ends allowing them to bind to one another easily.

31. Restriction Enzyme

32. Gel Electrophoresis DNA carries an electrical charge. Because of this, you can use an electrical charge to push or pull DNA fragments apart. This process is called electrophoresis. Often times, electrophoresis is performed in a semi-solid gel, which allows the molecules to move slowly. When a current is applied, shorter fragments will move faster than large fragments. The result is a lane of fragments sorted by size. If the lane is clear, this is called a ladder. If the fragments overlap, this is called a smear.

33. Gel Electrophoresis

34. Polymerase Chain Reaction (PCR) The PCR process is widely used to clone DNA sequences for further study or manipulation. PCR imitates the normal process of DNA replication. As long as the right components are used in a test tube, along with the right temperatures, PCR will be successful.

36. Recombinant Cloning Inserting a gene into an organism that replicates easily. Produced the first genetically modified organisms (GMOs).