Presentation is loading. Please wait.

Presentation is loading. Please wait.

Chlorophyll fluorescence analysis of green alga

Similar presentations


Presentation on theme: "Chlorophyll fluorescence analysis of green alga"— Presentation transcript:

1 Chlorophyll fluorescence analysis of green alga
Chlorella transgenic 簡麗鳳 (Lee-Feng Chien) 中興大學生命科學系

2 Green alga Chlorella sp. DT
Chlorella sp. DT (Desiccation Tolerance) (1000X) (a Taiwan native strain) Chlorella vulgaris

3 Chlorella transformed with foreign genes by electroporation
Vector Vector Gene pulser II (Bio-Rad) Cell wall Membrane 25 µF 200  1.8 kV cm-1 Chlorella (5 x 105) Recovery Plating Select DT transformants In dark 12 hr 5~10 days Hygromycin 75 μg ml-1

4 Chlorella transformed with foreign genes by agrobacterium-mediation
(Agro-Oa) (Agro-Ob) ξ ξ Co-culture with agrobacteria Plating 2 days Chlorella (5 x 105) Cefotaxime 250 μg ml-1 Plating Select DT transformants 4 hr 5x105 cells ml-1 5~10 days Hygromycin 75 μg ml-1

5 MerA-mediated mercury detoxification
Hg0 () GSH GSSG GS-Hg merA gene 2GSH GS-Hg-SG Hg0 () MerA Hg2+ Hg2+ ROS Mitochondion Chloroplast Hg2+ Chen & Chien

6 pHm3A/35S vector carrying merA
Linearized pHm3A/35S merA HPT RB LB NPT II CaMV35S HindIII RBS NOST Ara-merA-F Ara-merA-R merA: Bacillus megaterium strain MB1 mercuric reductase Huang et al. 2006

7 Detection of merA gene in genomic DNA from Chlorella transgenics by PCR
+ pHm3A/35S positive control negative control marker WT 35S-1 35S-2 35S-3 35S-4 23.1 kb 9.4 kb 6.5 kb 4.3 kb 2.3 kb 2.0 kb 1.9 kb 0.5 kb Huang et al. 2006

8 Change in chlorophyll content of transgenic lines in the presence of 5 mM HgCl2
Huang et al. 2006

9 Change in chlorophyll content of DT transgenics in the presence of 5 mM HgCl2
control + 5 µM HgCl2 WT WT 35S-1 35S-2 35S-3 35S-4 Huang et al. 2006

10 Fv/Fm ratios decreased under moderate mercury stress
+5 μM HgCl2 Huang et al. 2006

11 Fv/Fm ratio rapidly declined under acute mercury stress
+ 20 µM HgCl2 Huang et al. 2006

12 H2 Green & clean factory to produce H2 2H+ Solar energy 4H+ + n O2
Green algae e n H2O

13 H2 Low yield of photobiological H2 production in green alga –O2
H2 production in a sealed (anaerobic) liquid culture of the green alga Chlamydomonas reinhardtii, showing the H2 bubbles as they emanate from the medium (

14 Hydrogenase (HydA), catalyzing H2 production, normally inhibited by O2
Red P700 HydA under certain conditions, during photosynthesis, there is a possibility for hydrogenase (so called HydA) to capture the electrons from ferredoxin and to reduce 2H+ into H2. However, HydA is normally inhibited by the O2, split by oxygen-evolving complex (OEC) at photosystem II (PSII). OEC (modified from Melis et al. 2001)

15 Strategy of improving H2 production: allow more e- flowing to HydA
15 Strategy of improving H2 production: allow more e- flowing to HydA  Homologously overexpressing HydA H2 NADPH HydA NADP+ 2H+ nH+ Chloroplast FNR ATP ADP e H+/e Fd ATPase Stroma e PQ Cytb6/f Thylakoid membrane PSII PSI PQH e Strategy 1, we applied, was to create anaerobic environment in the cells by knockdowning PsbO of OEC by RNA interference. And hopefully, it would lead to the production of H2. e e Lumun OEC PC e nH+ nH2O nO2+4H+

16 Sequencing hydA of Chlorella sp. DT
Partial genomic hydA : 2458 bp In 2 In 3 In 4 In 1 5’ UTR 3’ UTR In 5 Ex 1 Ex 2 Ex 3 Ex 4 Ex 5 Ex 6 Transit peptide (may be a transcription control region) Coding region of hydA (hydAc): 1305 bp 5’ UTR a shorter 3’ UTR Ex 4 Ex 5 Ex 6 Ex 3 Ex 2 Ex 1 Transit peptide

17 pHm3A-hydAc and pHyg3-hydAc
hydAc: hydrogenase from C.s. DT Act1 P: Actin1 promoter from rice B2T P: β-tubulin promoter from Chlamydomonas nos T: Nopaline synthase gene terminator hpt: Hygromycin (Hyg) phosphotransferase gene NPTII: neomycin (Neo) phosphotransferase II aph7: aminoglycoside phosphotransferease/Hyg resistant gene merA: mercury reductase gene from bacterium (Chien et al. 2012)

18 pHm3A-hydAc and pHyg3-hydAc
1.The hydAc was then constructed into two plasmids, either driven by Actin1 promoter or by a Chlamydomonas B2T promoter. hydAc: hydrogenase from C.s. DT Act1 P: Actin1 promoter from rice B2T P: β-tubulin promoter from Chlamydomonas nos T: Nopaline synthase gene terminator hpt: Hygromycin (Hyg) phosphotransferase gene NPTII: neomycin (Neo) phosphotransferase II aph7: aminoglycoside phosphotransferease/Hyg resistant gene merA: mercury reductase gene from bacterium (Chien et al. 2012)

19 Confirmation of DT-pHm3A-hydAc & DT-pHyg3-hydAc mutants
Template: DT genomic DNA 1.The mutants were confirmed by checking whether the hydAc was delivered into DT by PCR. 2. The PCR products amplified from DT genomic DNA showed that the transgenes exist in the mutants’ genome. (Chien et al. 2012)

20 Under aerobic condition: hydAc transcribed in the mutants
-Hyg +Hyg BH2 BH3 BH4 AH1 AH5 AH6 DT (WT) DT-pHyg3-hydA DT-pHm3A-hydA (A) pHm3A-hydAc DT-pHm3A-hydAc M AH1 AH5 AH6 AH8 1.0 kb Template: DT cDNA hydAc 0.5 kb Furthermore, when the algal cells cultivated under aerobic condition, the hydAc transcripts were observed in the mutants but not in the DT-WT. (B) pHyg3-hydAc DT-pHyg3-hydAc M DT-WT BH2 BH3 BH4 1.0 kb hydAc 0.5 kb (Chien et al. 2012)

21 Under aerobic condition: HydAc expressed in the mutants
DT-pHm3A-hydAc (A) kDa M DT-WT AH1 AH5 AH6 AH8 50 HydAc 40 30 PsbO 20 (B) DT-pHyg3-hydAc kDa M DT-WT BH2 BH3 BH4 50 By western blotting analysis, the HydAc proteins were observed in these mutants but not in the DT-WT. HydAc 40 30 PsbO 20 (Chien et al. 2012)

22 Under aerobic and +S conditions:
HydAc relative expression level in the mutants Relative expression level (fold) The AH1 and BH2 mutants have the highest relative expression of HydAc. (Chien et al. 2012)

23 Fv/Fm ratios of AH1 and BH2 mutants cultivated in flasks

24 Measuring H2 concentration by GC

25 AH1 and BH2 transgenics have 6-10 fold H2 production of the DT-WT
The H2 production was measured. (Chien et al. 2012)

26 Strategy of improving H2 production : create –O2 environment
26 Strategy of improving H2 production : create –O2 environment H2 NADPH HydA NADP+ 2H+ nH+ Chloroplast FNR ATP ADP e H+/e Fd ATPase Stroma e PQ Cytb6/f Thylakoid membrane PSII PSI PQH e e e Lumun Strategy 1, we applied, was to create anaerobic environment in the cells by knockdowning PsbO of OEC by RNA interference. And hopefully, it would lead to the production of H2. OEC PC e nH+ nH2O nO2+4H+  by knockdowning PsbA or PsbO by RNA interference

27 Knockdown of PsbA (D1) or PsbO to eliminating O2 evolving
27 Knockdown of PsbA (D1) or PsbO to eliminating O2 evolving PSII (photosystem II) psbA (D1) PsbO PsbA (D1)  PsbO  [O2]  OEC (oxygen-evolving complex) The method for knockdowning PsbO was RNA interference. nH2O nO2+4H+ (Hall and Rao 1999)

28 Principle of RNA Interference
28 Principle of RNA Interference (

29 Design of antisense-psbA (D1) or antisense-PsbO
antisense-psbO-a antisense-psbO-b antisense-psbA (A) (B) Chang, Lin & Chien

30 siRNA-psbA (d1) driven by CMV promoter
Hygr (hpt) Ampr pRPsbA (5364bp) CMV promoter siRNA-psbA GGATCC TTTCACGGATTAAAGAAG TTGATATCCG CTTCATCTTTAATCCGTGAAACG CTTAAG BamH I Sense Loop Antisense-psbA Hind III

31 siRNA-psbO-a driven by U6 promoter
31 siRNA-psbO-a driven by U6 promoter Two siRNA were designed and constructed into different plasmids. The siRNAs were either driven by a human U6 promoter, with two selective markers, cGFP and hygromycin resistant gene.

32 siRNA-psbO-b driven by CMV promoter
32 siRNA-psbO-b driven by CMV promoter Driven by a human CMV promoter, again with selective markers of cGFP and hygromcin resistant gene.

33 siRNA-psbO-a / siRNA-psbO-b driven by Actin1 promoter
33 siRNA-psbO-a / siRNA-psbO-b driven by Actin1 promoter Or driven by a rice Actin1 promoter, with selective marker hygromycin resistant gene,

34 d1 knockdown transgenics on Hyg containing plates
DT-WT d1 transformants 75 g ml-1 Hyg Lin & Chien

35 The expression of D1 protein in d1 knockdown transgenics
WT d1-1 d1-3 kDa M 36 D1 D1 22 16 6 Lin & Chien

36 HydA fragments transcribed from transgenics suggesting the induction of hydrogenase
psbO-2 psbO-3 WT d1-1 d1-3 psbO-5 d1-4 d1-5 0.4kb fragments of HydA transcribed from genomic DNA kb M 1.0 0.5 0.2 0.2kb fragments of Hyd transcribed from cDNA Lin & Chien

37 Reduced photosynthetic activity observed in transformants under S-supplied condition
Fv / Fm Day Lin & Chien, unpublished data

38 Reduced photosynthetic activity observed in transformants under S-deprived condition
Fv / Fm Day Lin & Chien, unpublished data

39 DT-pHm3A/psbO-a and DT-pHm3A/psbO-b transgenics grown on hygromycin-containing plates
DT-WT (1) -Hyg (2) +Hyg DT-pHm3A /psbO-a DT-pHm3A /psbO-b (3) (4) (5) (6) 75 g ml-1 Hyg Liu & Chien

40 Confirmation of DT-pHm3A/psbO-a and
40 Confirmation of DT-pHm3A/psbO-a and DT-pHm3A/psbO-b transgenics by detecting siRNA-psbO fragments Template: DT genomic DNA (A) (B) DT-pHm3A/psbO-a DT-pHm3A/psbO-b M DT-WT tnOa1 tnOa2 tnOa3 M DT-WT tnOb4 tnOb5 4.0kb 4.0kb 2.0kb 2.0kb 1.7 kb Actin1- siRNA- psbO-a- merA 1.6 kb Actin1- siRNA- psbO-b- merA 1.6kb 1.6kb 1.The mutants carrying siRNA, driven by Actin1 promoter, were confirmed by detecting the fragments using PCR. 2. The PCR products of actin1-siRNA-psbO fragments amplified from DT genomic DNA were observed, indicating that the transgenes exist in the mutants’ genome. 1.0kb 1.0kb Liu & Chien

41 Reduced protein amounts of PsbO in the mutants
41 Reduced protein amounts of PsbO in the mutants DT-pHm3A/psbO-a DT-pHm3A/psbO-b kDa M DT-WT tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 50 37 PsbO COX2 After analyzed by western blotting, in comparison to the wild type, the protein amounts of PsbO in these mutants were found to be reduced. 20 Liu & Chien

42 Induced HydA observed in the mutants carrying
42 Induced HydA observed in the mutants carrying siRNA-psbO driven by Act1 promoter (A) DT-pHm3A/psbO-a DT-pHm3A/psbO-b kb M DT-WT tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 Template: DT cDNA 0.5 hydA (0.51 kb) 0.2 (B) DT-pHm3A/psbO-a DT-pHm3A/psbO-b kDa M DT-WT tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 50 Induced HydA 1.Also. the hydA transcripts were observed in the mutants, carrying siRNA driven by actin-1 promoter, but not in the WT. 2. The induced HydA proteins were observed in these mutants as well. 37 COX2 20 Liu & Chien

43 psbO-knockdown transgenics in flasks under aerobic condition
-Hyg +Hyg tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 psbO-a DT-WT psbO-b 75 g ml-1 Hyg 0.6 0.7 0.8 0.9 1.0 0.84 0.72 0.69 0.71 tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 DT-WT PSII activities of DT transformants (B) Liu & Chien

44 44 psbO-knockdown transgenics with several fold H2 production of the DT-WT 30.3 98.5 352.1 142.3 131.5 113.3 H2 production (mL L-1) The results showed that the PsbO-knockdown mutants have several fold H2 production of the DT-WT. DT-WT tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 Liu & Chien

45 Fv/Fm ratios of psbO-knockdown transgenics during H2 production
0.34 0.29 0.28 0.27 0.27 0.25 Fv / Fm DT-WT tnOa1 tnOa2 tnOa3 tnOb4 tnOb5 Liu & Chien

46 Improving H2 production in DT transgenics
46 Improving H2 production in DT transgenics  Homologously overexpressing HydA H2 NADPH HydA NADP+ 2H+ nH+ Chloroplast FNR ATP ADP e H+/e Fd ATPase Stroma e PQ Cytb6/f Thylakoid membrane PSII PSI PQH e e e Strategy 1, we applied, was to create anaerobic environment in the cells by knockdowning PsbO of OEC by RNA interference. And hopefully, it would lead to the production of H2. Lumun OEC PC e nH+ nH2O nO2+4H+  knockdowning PsbO

47 Acknowledgments: Co-authors: Thanks to: Prof. Chieh-Chen Huang (NCHU)
47 Acknowledgments: Thanks to: Prof. Pei-Chung Chen (NCHU) Prof. Tsanyao F. Yang (NTU) Dr. Yi-Hsien Lin (NPTU) Da-Wei Yang (NCHU) Hsieh-Chin Tsai Co-authors: Prof. Chieh-Chen Huang (NCHU) Prof. Ting-Yung Feng (Academia Sinica) Hsin-Di Lin (NCHU) Bang-Hong Liu Ting-Ting Kuo Hen-Yi Chang Funding: NSC, AUT Plan, AS of Taiwan

48 Thank you for your attention

49 Chlorophyll a fluorescence at PSII
Chl a fluorescence hv Chl a Heat PSII P680 PSI P700 e- PQCytb6f PC e- e- NADHR e- NADP+ 2H2O NADPH 4H+ + O2

50 Chlorophyll Fluorescence Parameters
Dark-adapted Light-adapted Fm Fv Fm’ Fv’ Fs Fo Saturating pulse Saturating pulse Measuring beam Measuring beam Fm: maximal chlorophyll fluorescence Fv: variable chlorophyll fluorescence Fo: minimal chlorophyll fluorescence Fv/Fm: represents the photosynthetic activity Popp, 2000


Download ppt "Chlorophyll fluorescence analysis of green alga"

Similar presentations


Ads by Google