Presentation is loading. Please wait.

Presentation is loading. Please wait.

Supplementary Material The phytohormone ethylene enhances cellulose production, regulates CRP/FNR transcription, and causes differential gene expression.

Published byMarlene Ross Modified over 8 years ago

Similar presentations

Presentation on theme: "Supplementary Material The phytohormone ethylene enhances cellulose production, regulates CRP/FNR transcription, and causes differential gene expression."— Presentation transcript:

1 Supplementary Material The phytohormone ethylene enhances cellulose production, regulates CRP/FNR transcription, and causes differential gene expression within the bacterial cellulose synthesis operon of Komagataeibacter (Gluconacetobacter) xylinus ATCC 53582 Richard V. Augimeri 1 and Janice L. Strap 1* 1 Molecular Microbial Biochemistry Laboratory, Faculty of Science, University of Ontario Institute of Technology, Oshawa, ON, Canada * Correspondence: Janice L. Strap: janice.strap@uoit.ca

2 Supplementary Figures

3 Supplementary Figure 1. Triple response of Arabidopsis thaliana to ethylene. Schematic (A-C) illustrating the composition of each quadrant. Photographs (D-F) show the assay plates for the negative control (A, D), the positive control (B, E) and the experimental (ethephon) (C, F) triple response.

4 Supplementary Figure 2. Ethephon-derived ethylene causes an increase in the final pH of K. xylinus broth cultures. Cultures were grown in SH broth (pH 7) supplemented with ethephon and 0.2% (v/v) cellulase, incubated at 30 o C with agitation at 150 rpm. Data was normalized to, and expressed as percent of the untreated control. Data presented indicates the final culture pH after 14 days of growth. Note that the y-axis begins at 50%. Error bars show SD (n = 3). *** = p < 0.001.

5 Supplementary Figure 3. Ethephon does not affect the growth of K. xylinus when grown in agitated liquid culture. Cultures were grown in the presence of ethephon that was added at the time of inoculation (A) and every 2 days (B). The legend indicates the ethephon concentrations tested. Cultures were grown in a 96-well plate in SH broth (pH 7) supplemented with 0.4% (v/v) cellulase incubated at 30 o C with agitation at 150 rpm. Error bars show SD (n = 3).

6 Supplementary Figure 4. Standard curve (A) and melt-curve (B) analysis for 23SrRNA primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

7 Supplementary Figure 5. Standard curve (A) and melt-curve (B) analysis for gyrB primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

8 Supplementary Figure 6. Standard curve (A) and melt-curve (B) analysis for bcsA primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

9 Supplementary Figure 7. Standard curve (A) and melt-curve (B) analysis for bcsB primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

10 Supplementary Figure 8. Standard curve (A) and melt-curve (B) analysis for bcsC primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

11 Supplementary Figure 9. Standard curve (A) and melt-curve (B) analysis for bcsD primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

12 Supplementary Figure 10. Standard curve (A) and melt-curve (B) analysis for cmcAx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

13 Supplementary Figure 11. Standard curve (A) and melt-curve (B) analysis for ccpAx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

14 Supplementary Figure 12. Standard curve (A) and melt-curve (B) analysis for bglAx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

15 Supplementary Figure 13. Standard curve (A) and melt-curve (B) analysis for crp/fnr Kx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

16 Supplementary Tables

17 1 Represents the strains of K. xylinus whose genome sequences were used to design each primer set 2 These locus tags identify each gene and can be found within the genome sequences of the respective K. xylinus strain. 3 Locus tag- Genome accession: AP012159.1 4 Locus tag- Genome accession: CP004360.1 5 Gene accession numbers Supplemental Table 1. Details of primer sets used in this study. GeneDesign Strain 1 Accession/Locus Tag 2 Amplicon length (bp)Forward primer sequence (5’→3’)Reverse primer sequence (5’→3’) Reference Genes 23SrRNANBRC 3288GLX_r0020 3 255TGAGCTGGGTTTAGAACGTCGTGACACCTGGCCTATTGACGTGATG gyrBE25H845_869 4 108TCTCGTCACAGACCAAGGACAAGCTTCCTTGGGGTGGGTTTCAAAC Target Genes bcsAATCC 53582X54676 5 184ACAATGGGCTGGATGGTCGAACCCGCAAAAGAAGGTCGCA bcsBATCC 53582X54676.1 5 197AATGCGTTCCATCTTGGGCTTGACATCAGGTCAAGATAGGCGCCAACA bcsCATCC 53582X54676.1 5 103TACCAGTCGCATATCGGCAATCGTGCAGGTCGTTCAACTGGCTTTCAT bcsDATCC 53582X54676.1 5 153TCACCCTGTTTCTTCAGACCCTGTTCAGTTCGATCTGCAGCTTGTCCA cmcAxATCC 53582AB091058.1 5 98CACCAACCTGCAGCATACCAATGACGCCATCTGTGGCATTGTTCTTGT ccpAxATCC 53582AB091058.1 5 191TGTTGCCGATGAATGGAGTCCTGTTGTCTGTCTTGGTCATGCTGGTCA bglAxATCC 53582AB091059.1 5 116TACCGATCAGGAACTTGTCTATCAAAAGTGGTGTAGGTCAGG crp/fnr Kx E25H845_3156 4 138TCAGGCAGCGCCTTGAACAGCTTGACCTGACATTTCCCGCCTGTCCGAAGCAGC

18 Gene[Primer] (nM)T a, opt. ( o C)E (%)R2R2 [Template] (dilution factor) Reference Genes 23SrRNA30062.0100.00.9992000X gyrB50060.0106.70.996100X Target Genes bcsA50066.4100.50.995100X bcsB30062.499.60.991100X bcsC50060.099.00.991100X bcsD50060.098.80.983100X cmcAx50056.794.50.997100X ccpAx50060.099.40.984100X bglAx50062.0105.00.986100X crp/fnr Kx 50060.0103.10.997100X Supplemental Table 2. Results of RT-qPCR assay optimization.

Download ppt "Supplementary Material The phytohormone ethylene enhances cellulose production, regulates CRP/FNR transcription, and causes differential gene expression."

Similar presentations

Supplementary Figure 1. AB Supplementary Figure 1. L1 and Alu retrotransposition assay. A. Schematic of L1 retrotransposition plasmid (L1). ORF1 and ORF2.

Supplementary Figure 1. AB Supplementary Figure 1. L1 and Alu retrotransposition assay. A. Schematic of L1 retrotransposition plasmid (L1). ORF1 and ORF2.
Table 2 shows that the set TFsf-TGblbs of predicted regulatory links has better results than the other two sets, based on having a significantly higher.

Table 2 shows that the set TFsf-TGblbs of predicted regulatory links has better results than the other two sets, based on having a significantly higher.
1 100 120 University of Oklahoma Genome Center4/14/12.

University of Oklahoma Genome Center4/14/12.
Logo Introduction To investigate if white 96-well plates allow better fluorescence detection of PCR products during QPCR assays than natural 96-well plates.

Logo Introduction To investigate if white 96-well plates allow better fluorescence detection of PCR products during QPCR assays than natural 96-well plates.
-4.5 -4 -3.5 -3 -2.5 -2 -1.5 -0.5 0 05101520 Ct log DNA （ pmol) P1P2 Supplementary Fig. S1 Standard curve of the PCR amplification efficiency of transcripts.

Ct log DNA （ pmol) P1P2 Supplementary Fig. S1 Standard curve of the PCR amplification efficiency of transcripts.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.

Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Supplemental Figure 1a. SDS-PAGE analysis showing OMPs expressed by V. tubiashii strain 19105. From left to right, Lane 1, cells grown in the presence.

Supplemental Figure 1a. SDS-PAGE analysis showing OMPs expressed by V. tubiashii strain From left to right, Lane 1, cells grown in the presence.
220 160 120 100 90 80 70 60 50 40 30 15 min 30 min 45 min 60 min KDa Figure S1. SDS-PAGE of supernatant after incubation in digestion buffer. L. monocytogenes.

min 30 min 45 min 60 min KDa Figure S1. SDS-PAGE of supernatant after incubation in digestion buffer. L. monocytogenes.
0 0.1 0.2 0.3 0.4 0.5 0.6 WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)

WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)
SPECIFICITY and SENSITIVITY – Performance of Applied qPCR Assays A Bacteria Methanogenic Archaea F FBacteria F FF F Supplementary Figure 1: Specificity.

SPECIFICITY and SENSITIVITY – Performance of Applied qPCR Assays A Bacteria Methanogenic Archaea F FBacteria F FF F Supplementary Figure 1: Specificity.
Date of download: 5/28/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Increased BDNF Promoter Methylation in the Wernicke.

Date of download: 5/28/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Increased BDNF Promoter Methylation in the Wernicke.
H. influenzae genes differentially regulated during growth in complex media and during lung infection in the presence of corticosteroids AVenn diagram.

H. influenzae genes differentially regulated during growth in complex media and during lung infection in the presence of corticosteroids AVenn diagram.
Clinical Laboratory Analysis of Immunoglobulin Heavy Chain Variable Region Genes for Chronic Lymphocytic Leukemia Prognosis  Philippe Szankasi, David.

Clinical Laboratory Analysis of Immunoglobulin Heavy Chain Variable Region Genes for Chronic Lymphocytic Leukemia Prognosis  Philippe Szankasi, David.
Chapter 8, part B Microbial Genetics.

Chapter 8, part B Microbial Genetics.
Chapter 8, part B Microbial Genetics.

Chapter 8, part B Microbial Genetics.
Supplementary figure 5.

Supplementary figure 5.
Figure 1. miRNA processing and primer design

Figure 1. miRNA processing and primer design
Targeting Multidrug-resistant Staphylococci with an anti-rpoA Peptide Nucleic Acid Conjugated to the HIV-1 TAT Cell Penetrating Peptide  Mostafa FN Abushahba,

Targeting Multidrug-resistant Staphylococci with an anti-rpoA Peptide Nucleic Acid Conjugated to the HIV-1 TAT Cell Penetrating Peptide  Mostafa FN Abushahba,
* * * Fig. S1 XB21-Os12g36180 Os11g43950 At4g12770 At4g

* * * Fig. S1 XB21-Os12g36180 Os11g43950 At4g12770 At4g
One-Step Ligation on RNA Amplification for the Detection of Point Mutations  Lei Zhang, Jingjing Wang, Mia Coetzer, Stephanie Angione, Rami Kantor, Anubhav.

One-Step Ligation on RNA Amplification for the Detection of Point Mutations  Lei Zhang, Jingjing Wang, Mia Coetzer, Stephanie Angione, Rami Kantor, Anubhav.

Similar presentations

Ads by Google