1. DNA DNA (Deoxyribonucleic Acid) is the molecule that stores genetic information for all living cells.

2. History of DNA In 1869 a Swiss scientist, Friedrich Miescher discovers the DNA molecule. He was not really sure what he had discovered.

3. Friedrich Meischer

4. History of DNA By 1940 scientist’s knew that chromosomes (46 in humans) consisted of DNA and proteins. Many different scientist were working on various aspects of how DNA worked.

5. History of DNA In 1949 Erwin Chargaff discovers that adenine & thymine always equal each other and cytosine and guanine always equal each other. His discovery became known as Chargaff’s Rule.

6. Edwin Chargaff

7. History of DNA Early 1953 Rosalind Franklin who had worked on x-ray diffraction images of the DNA molecule for years was preparing to present her research work and she had to leave the Kings College of London before this presentation was made. Watson and Crick were given access to her unpublished papers and they used the information to present their Double Helix theory of DNA.

8. Rosalind Franklin

9. History of DNA In 1953 Watson and Crick presented “their” DNA’s double helix structure. They were awarded the 1962 Nobel Prize for their discovery of DNA’s Double Helix along with Maurice Wilkins who was Rosalind Franklin’s working partner. Little or no credit was given to Rosalind Franklin.

10. Original DNA Molecule

11. Watson and Crick

12. DNA Facts The DNA molecule is very long (up to 2 meter in a single cell) and is made up of sub units called nucleotides. Each nucleotide is made up of a 5 carbon sugar (deoxyribose), a phosphate group (PO 4 - ), and a nitrogen base (adenine, thymine, guanine, and cytosine).

13. DNA Molecule Appearance

14. Nitrogen Bases of DNA There are 4 nitrogen bases used with the DNA molecule: Adenine, Thymine, Guanine, and Cytosine. Adenine and Thymine always bond together and Guanine and Cytosine always bond together. The bond between the nitrogen bases is a weak hydrogen bond which makes it easy for the DNA molecule to “Unzip” when it is time to replicate.

15. DNA Nitrogen Bases

17. DNA Replication DNA replication takes place during Interphase of the cell cycle. Specifically in the S step of Interphase.

18. DNA Replication The enzyme helicase cuts or unzips the DNA molecule exposing the bases on each leg to the nitrogen bases that will bond with them to create the copy of the DNA molecule before going onto mitosis.

19. Practice Problems ATCGTAGC old leg of DNA TAGCATCG New leg of DNA

20. Practice Problems CCATATGG old leg of DNA GGTATACC New leg of DNA

21. Practice Problems AAATCGGCT old leg of DNA TTTAGCCGA New leg of DNA

22. Practice Problems CGGTACGATT Old leg of DNA GCCATGCTAA new leg of DNA

23. Practice Problems TTGGCACGT Old leg of DNA AACCGTGCA New leg of DNA

24. DNA to DNA Complimentary Original leg of DNA GCATCGTCGACCGATTAGGT DNA complimentary leg CGTAGCAGCTGGCTAATCCA

25. Old leg AACGTTCCATAACCCTGGAT Old leg TTGCAAGGTATTGGGACCTA To replicate the DNA, an enzyme helicase cuts the weak hydrogen bonds and two separate legs. Then an enzyme DNA polymerase brings the nitrogen base pairs to create the complimentary leg of the replicated DNA molecule. New leg TTGCAAGGTATTGGGACCTA New leg AACGTTCCATAACCCTGGAT

26. Old leg CCCGGGATATCTAGTAGGTA Old leg GGGCCCTATAGATCATCCAT Helicase now splits the two DNA legs preparing to replicate. What do the two complimentary legs look like? New leg GGGCCCTATAGATCATCCAT New leg CCCGGGATATCTAGTAGGTA

27. Old leg TACTGATAGAAGGTTCCGTA Old leg ATGACTATCTTCCAAGGCAT Helicase splits the two legs of DNA. What do the two new legs of DNA complimentary look like? New leg ATGACTATCTTCCAAGGCAT New leg TACTGATAGAAGGTTCCGTA

28. Change in DNA base sequences Changes in the DNA base sequences are called mutations. There are three types of mutations 1.Substitutions 2.Insertions 3.Deletions