1. Short Read Workshop Day 5: Mapping and Visualization
Video 2
Bowtie Short Read Alinger

2.
Bowtie is an ultrafast, memory-efficient short read aligner geared towards quickly aligning large sets of short DNA sequences (reads) to large genomes.
We like Bowtie for single-end read alignment

3.
Bowtie is an ultrafast, memory-efficient short read aligner geared toward quickly aligning large sets of short DNA sequences (reads) to large genomes.
We like Bowtie for single-end read alignment
Bowtie
Only local alignment of reads (no gapped alignment)
Optimized for short read lengths (25-50bp); max read length 1000bp
Reads not allowed to overlap ambiguous characters (N, Y, R)
Colorspace support
Bowtie2
Local, end-to-end/gapped read alignment options
Optimized for long read lengths (≥50bp); no max read length
Allows read to overlap multiple ambiguous characters (N, Y, R)
No colorspace support

4. Bowtie Alignment Options
-v Read Mismatch
Allow –v <int> mismatches in whole read
Where <int> = 0-3
Quality score is ignored
-n Seed Mismatch (default)
Allow -n <int> mismatches in seed region
Where <int> = 0-3
Seed length = -l <int>
Where <int> > 5

5. Bowtie Alignment Options
-v Read Mismatch
Allow -v <int> mismatches in whole read
Where <int> = 0-3
Quality score is ignored
-n Seed Mismatch (default)
Allow -n <int> mismatches in seed region
Where <int> = 0-3
Seed length = -l <int>
Where <int> > 5
10mer seed region
Read: ATGCAGCTAGCTATCTAGGTAGAT
||||||||||||| |||| ||| |
Genome: ATGCAGCTAGCTAGCTAGCTAGCT
Settings: n 0 -l 10

6. Bowtie Alignment Options
-v Read Mismatch
Allow -v <int> mismatches in whole read
Where <int> = 0-3
Quality score is ignored
-n Seed Mismatch (default)
Allow -n <int> mismatches in seed region
Where <int> = 0-3
Seed length = -l <int>
Where <int> > 5
Read: ATGCAGATAGCTATCTAGCTAGCT
|||||| |||||| ||||||||||
Genome: ATGCAGCTAGCTAGCTAGCTAGCT
Settings: v 2

7. Bowtie Alignment Report Options
@read1
@read2
Chr3
Chr3
Chr1
Chr1
Non-uniquely mapping read
Uniquely mapping read

8. Bowtie Alignment Report Options
@read1
@read2
Chr3
Chr3
Chr1
Chr1
Non-uniquely mapping read
Uniquely mapping read
Bowtie Option To Control Alignment Reporting
-k <int> report up to <int> alignments for each read (default -k 1)
-a reports all valid alignments for each read
-m <int> prevents reporting reads with > int alignments
(use –m 1 to report only uniquely mapping reads)
-S for SAM output

9. Reference genome index
Using Bowtie
1.) index reference genome with Bowtie-build (Video 1)
2.) Command line setup or
Set options like -n or -v
Reference genome index
Alignment Output File
Read file input
Bowtie by default assumes your reads are in a fastq file, for other file formats you must specify the format of the reads

10. Reference genome index
Using Bowtie
1.) index reference genome with Bowtie-build (Video 1)
2.) Command line setup or
Set options like -n or -v
Reference genome index
Alignment Output File
Read file input
Most basic, default setting run of bowtie
Bowtie by default assumes your reads are in a fastq file, for other file formats you must specify the format of the reads
$ bowtie -S index reads.fq bowtie-out.sam 2> bowtie-out.stderr
If you were running paired-end reads
$ bowtie -S index -1 fwd_reads.fq -2 rev_reads.fq bowtie-out.sam

11. Bowtie Alignment Report Options
@read1
Uniquely
mapping read
Chr3
Chr1

12. Bowtie Alignment Report Options
@read1
Uniquely
mapping read
Chr3
Chr1
Bowtie Option To Control Alignment Reporting
-k <int> report up to <int> alignments for each read (default -k 1)
-a reports all valid alignments for each read
-m <int> prevents reporting reads with > int alignments
(use –m 0 to report only uniquely mapping reads)
-S for SAM output

13. Bowtie2 Bowtie2 ≠ Bowtie Bowtie2 can perform gapped alignments
--local versus --end-to-end
Uses a scoring scheme based on matches, mismatches, gap opens, gap extensions to identify read alignments
generally faster and more sensitive for reads >50bp long
Unlike v1, Bowtie v2 can perform gapped alignments
Must choose between --local and --end-to-end alignment, default is Is generally faster and more sensitive for reads >50nt long
Uses a scoring scheme based on matches, mismatches, gap opens, gap extentions to dictate alignment report

14. Bowtie2 end-to-end Alignment
Global/end-to-end alignment (default)
Align the whole read
Option: --end-to-end
Can control how many gaps, how long, etc.
Read: ATGCAGCTAGCTAGCTAGCTAGCT
||||||||||||||||||||||||
Genome: ATGCAGCTAGCTAGC---CTAGCT
3nt insertion
Read: ATGCA--TAGCTAGCTAGCAAGCT
||||||||||||||||||||||||
Genome: ATGCAGCTAGCTAGCTAGCTAGCT
2nt deletion
1 mismatch

15. Bowtie2 end-to-end Alignment
Global/end-to-end alignment (default)
Align the whole read
Option: --end-to-end
Can control how many gaps, how long, etc.
Preset Alignment options:
--very-fast
--fast
--sensitive (default) = -D 15 -R 2 -L 22 -i S,1,1.15
--very-sensitive
-D determines how many extensions to try for a given seed match
-L dictates seed length for multiseed alignment

16. Bowtie2 Local Alignment
Soft trimming/clipping
Can include gaps
Option: --local
Also has -local versions of preset options
--sensitive-local (default) = -D 15 -R 2 -N 0 -L 20 -i S,1,0.75
Read: ATGCAGCTAGCTAGCTAGCTAGCT
|||||||||||||||||||
Genome: GCACAGCTAGCTAGCTAGCTAGAC
3’ and 5’ soft trimming
-N dictates mismatches allowed in seed region

17. Bowtie2 Local Alignment
Soft trimming/clipping
Can include gaps
Option: --local
Also has -local versions of preset options
--sensitive-local (default) = -D 15 -R 2 -N 0 -L 20 -i S,1,0.75
Read: ATGCAGCTAGCTAGCTAGCTAGCT
|||||||||||||||||||
Genome: GCACAGCTAGCTAGCTAGCTAGAC
3’ and 5’ soft trimming
-N dictates mismatches allowed in seed region

18. Bowtie2 Reporting Options
Default to report a single alignment per read
-a report all valid alignments
-k set how many alignments per read

19. Reference genome index
Using Bowtie2
1.) index reference genome with bowtie2-build (Video 1)
-bowtie indexes not compatible with bowtie2 and vice versa
2.) Command line setup
Set options like --local
Reference genome index
Alignment Output
SAM File
Read file input

20. Reference genome index
Using Bowtie2
1.) index reference genome with bowtie2-build (Video 1)
-bowtie indexes not compatible with bowtie2 and vice versa
2.) Command line setup
Set options like --local
Reference genome index
Alignment Output
SAM File
Read file input
Most basic, default setting run of bowtie
$ bowtie2 --local -x index reads.fq -S bowtie-out.sam 2> bowtie-out.stderr
If you were running paired-end reads
$ bowtie2 --fr --local -x index -1 fwd_reads.fq -2 rev_reads2.fq -S bowtie-out.sam

21. Capture standard error from Bowtie(2)
Only local alignment of reads (no gapped alignment)
Bowtie2
Local, end-to-end/gapped read alignment options
Capture standard error from Bowtie(2)
Output SAM file can be used with a number of downstream applications
Use SAMTools to convert to BAM file