1. Transcription and Translation – 2/22 Required notes (paraphrase!) This presentation is available online (“Transcription and translation”) I assume that you all carefully read 12-3 beforehand. If you didn’t get it all, reread 12-3 and review the presentation at home.

2. Review the Paper Model Activity Questions 9 and 10?

3. Types of RNA What are the three types of RNA? Messenger RNA (mRNA) Takes info from DNA (nucleus) to ribosomes (cytoplasm) Ribosomal RNA (rRNA) Ribosomes are made of rRNA (and proteins) Transfer RNA (tRNA) Transfers amino acids to the ribosome Transcription – how would you define it based on the reading?

4. Transcription - defined Transcription – what is it? Process in which the information from a section of double-stranded DNA is converted into complimentary, single-stranded mRNA.

5. Transcription – 1 Process in which the information from a section of double-stranded DNA is converted into complementary, single-stranded mRNA. DNA RNA polymerase finds promoter (“start here”) region Separates (“unzips”) two strands. Note – helicase unzips in replication Transcription can then occur on either/both strands. What would be the first base on the mRNA created from the bottom DNA? DNA TATAAATTATTATACCGTTGGCCC ATATTTAATAATATGGCAACCGGG Promoter (sequence varies)

6. Transcription - 2 DNA RNA polymerase next finds the “TATA” box. What bases are in TATA boxes? (a region of repeating T’s and A’s in most eukaryotes). Then removes “introns” and transcribes only the “exons” How many bases would be transcribed (only exons)? DNA TATAAATTATTATACCGTTGGCCC ATATTTAATAATATGGCAACCGGG

7. Transcription - 3 DNA RNA polymerase creates single stranded mRNA using only exons (exons = “expressed” DNA, introns are “in between,” edited out) Base pair rules; but “uracil” is in place of thymine. What’s wrong here? “spell checks” mRNA, sends to ribosome DNA TATAAATTATTATACCGTTGGCCC ATATTTAATAATATGGCAACCGGG mRNA AUG ACCGGT ACCGGG

8. Transcription - 4 DNA DNA strands come back together (double-stranded again) mRNA is single-stranded and goes to ribosomes ***mRNA never attaches to DNA!*** DNA TATAAATTATTATACCGTTGGCCC ATATTTAATAATATGGCAACCGGG mRNA AUG ACCGGG Cytoplasm Stays in nucleus

9. Transcription http://highered.mheducation.com/sites/0072556781/student_view0/c hapter12/animation_quiz_1.html http://highered.mheducation.com/sites/0072556781/student_view0/c hapter12/animation_quiz_1.html http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html http://www.johnkyrk.com/DNAtranscription.html

10. Translation- defined Translation– what is it? Discuss, be ready to share When mRNA is converted to a chain of amino acids (protein!). 20 naturally occurring amino acids Order of these a.a. determines shape & function of protein. What is the amino acid order called? Primary structure! (The “spelling” of the protein)

11. Translation – 2 When mRNA is converted to a chain of amino acids (protein!). 20 naturally occurring amino acids Order of these a.a. (primary structure) determines shape & function of protein. mRNA AUG ACCGGG tRNA (LOTS available in cytoplasm) UAC UGG CCC anti-codon codon (3 bases) ACG RIBOSOME

12. Translation - 3 mRNA AUG ACCGGG tRNA (attached to amino acids See page 303.) UAC UGG CCC ACG methionine threonine glycine cysteine RIBOSOME

13. Translation - 4 mRNA AUG ACCGGG tRNA (randomly moves around; binds with correct codon) UAC UGG CCC ACG methionine threonine glycine cysteine RIBOSOME

14. Translation - 5 mRNA AUG ACCGGG tRNA (randomly moves around; binds with correct codon) UGG CCC ACG Methionine- threonine glycine cysteine RIBOSOME

15. Translation - 6 mRNA AUG ACCGGG tRNA Only correct tRNA molecules are used; unlimited amounts of all types are available. CCC ACG Methionine- threonine glycine cysteine RIBOSOME

16. Translation - 7 mRNA AUG ACCGGG tRNA Only correct tRNA molecules are used; unlimited amounts of all types are available. ACG Methionine- threonine- glycine cysteine RIBOSOME

17. Translation - 8 mRNA AUG ACCGGG Methionine- threonine-glycine  goes to ER, Golgi, and beyond! This example protein is three amino acids long; most are hundreds to thousands Protein is then finished (ER) and packaged up (Golgi) for use… mRNA is used again Note: AUG is common “start” codon; can you find a “stop” codon? RIBOSOME

18. http://www.wiley.com/college/test/0471787159/biology_basics/an imations/fromGeneToProtein.swf http://www.wiley.com/college/test/0471787159/biology_basics/an imations/fromGeneToProtein.swf http://www.sciencenetlinks.com/interactives/protein.html