1. 1 High Throughput Cloning and Expression of NESG Targets Jan 2006 Dongyan Wang

2. 2 Cloning and Expression Procedures (1) *Design and order primers *PCR& Gel extraction Restriction Digestions Digestion cleanup Drying and filtration Restriction Digestion *Ligation Transformation into XL-Gold cells *Colony screening PCR & gel @Miniprep (Archive DNA and GS) *Miniprep culture * : Data entry into Excel spreadsheet @ : Enter target set into Platemaster : Steps involving Robot Fragments cloned into vectors

3. 3 Transformation into Magik cells Take gel pictures (or scan and upload) and score. *Run samples on SDS- PAGE gels, stain and de-stain. IPTG induction Harvest, sonication, and sample preparation MJ9 culture and dilution @Expression LB culture (Archive GS) Upload to Spine Competition analysis and decision making *Data entry @Verify Archive *Transfer to fermentation Cloning and Expression Procedures (2) Fragments cloned into vectors

4. 4 Work Flow of a Single Process

5. 5 >ER84 atgtcccgagtctgccaagttactggcaagcgtccggtgaccggtaacaaccgttcccacgcactgaacgcgactaaacgccgtttcctgccgaacctgc actctcaccgtttctgggttgagagcgagaagcgttttgtcaccctgcgc gtatctgctaaaggtatgcgtgtaatcgataaaaaaggcatcgatacagt tctggctgaactgcgtgcccgtggcgaaaagtactaa Primers for Target sets -2 weeks Target sequence in FASTA format: Copy & Paste Primer seq. output

6. 6 A1SR430,pET 21-23C,F,NdeI,66,34,172,,ATCGATCGCATATGATGAGCCGCTATGCAAAATG Well TargetPlasmidDirSequenceSize(bp) Ext REInt RE A1 SR430pET 21-23CFATCGATCGCATATGATGAGCCGCTATGCAAAATG172NdeInone B1 SR482pET 21-23CFATCGATCGCATATGTTGAACATTGAAAGGCTCACTAC352NdeIHindIII Primer data copied from Primer pri’mer is pasted into Excel worksheet: Primer data parsed into different fields WellTarget Size (bp) MW (KD)Ext RE Site Internal RE SitesVectorPCRLig Dig A1SR4301727.1NdeI/XhoInone21-23CBamHI B1SR48235213.7NdeI/XhoIHindIII21-23CBamHI Target data entered into Set Summary Worksheet Same data used to order primer synthesis in 96-well format from Operon

7. 7 1 set = 96 targets PCR and purification of target fragments (1) Day 1-2 96 pairs of gene-specific primers And Genomic DNA template 96 PCR reactions PCR products separated On 2% agarose gel WellTarget Size (bp) MW (KD)Ext RE Site Internal RE SitesVectorPCRLig Dig A1SR4301727.1NdeI/XhoInone21-23CyesBamHI B1SR48235213.7NdeI/XhoIHindIII21-23CnoBamHI Results entered into Excel worksheet Gel pic storage Comment field:reason/size

8. 8 PCR and purification of target fragments (2) Day 1-2  Bands of right sizes are manually cut and put into a 96-well block.  Gel slices melted at 55 C.  Automated gel extraction using Qiagen robot.

9. 9 Problems that may arise  Some organism’s genome is GC rich. Requires GC- rich PCR kit and longer elongation times.  No PCR products or wrong size.  Robot malfunctions. Target sequence GC%

10. 10 Day 2-3  5’ and 3’ restriction endonuclease digestions for directional cloning.  2 overnight 37 C reactions. Restriction Digestions WellTarget Size (bp) MW (KD)Ext RE Site Internal RE SitesVectorPCRLig Dig A1SR4301727.1NdeI/XhoInone21-23CyesBamHI B1SR48235213.7BamHI/XhoIHindIII21-23CnoEcoRII Graphic tools for helping locating different RE/Lig wells

11. 11 Cleaning and filtration Day 4  Automated digestion cleaning up using Qiagen robot.  Lyophilize the plate in speed vacuum till dry.  Resuspend in dH2O.  Purify DNA using 96-well Centri-Sep plate. Explore non Centri-Sep methods

12. 12 Ligation Day 4-5  Ligation reaction at 16 C overnight with:  Cut and purified target DNA PCR product.  Appropriate precut pET vectors.  T4 DNA ligase.  65 C 10 min to inactivate the ligase.  Ligation digestion at 37 C for 1 hr. WellTarget Size (bp) MW (KD)Ext RE Site Internal RE SitesVectorPCRLig Dig A1SR4301727.1NdeI/XhoInone21-23CyesBamHI B1SR48235213.7BamHI/XhoIHindIII21-23CnoEcoRII Graphic tools for helping locating different RE/Lig wells

13. 13 Transformation into XL-gold Day 5-6  Mix XL-gold competent cells with digested ligated DNA on ice.  Heat shock at 42 C 1 min.  Incubate with SOC 37 C 1 hr.  Plate on LB/Amp plates.  Incubate overnight 37 C. 96 LB/Amp plates

14. 14 Result of transformation into XL-gold Day 6 Primer Well# of colonies A15 B10 C120 D112 E120 F120 G120 H120 Enter the number of colonies of each target into worksheet

15. 15 Colony screening (1) Day 6-7  Pick 2 colonies per target, resuspend in water.  PCR reactions with T7 primers, which anneals to vector sequences flanking the inserts.  Run PCR products on 2% agarose gel.  Select clones with right size.  Enter result into Excel worksheets. Well Primer WellTarget Clone #PlasmidFull Name Expected Size (bp) Right Size? Picke d? A1 SR430121-23CSR430-21.1372no B1A1SR430221-23CSR430-21.2372yes C1B1SR482121-23CSR482-21.1552yes D1B1SR482221-23CSR482-21.2552yes

16. 16 Colony screening (2)  For the targets with only one or no positive clones, pick more clones from the XL-gold transformation plate.  Repeat colony PCR.  Enter result into Excel worksheets.  Repeat these steps if needed. Extra 1-2 days Well Primer Well Clone #PlasmidFull Name Expected Size (bp) Right Size?Picked? A1 321-23CSR430-21.3372no B1A1421-23CSR430-21.4372yes C1E8321-23CSR465-21.3555yes D1E8421-23CSR465-21.4555yes 192 clones

17. 17 Miniprep culture Day 7-8  Fill out the Miniprep Setup Excel worksheet.  Inoculate 10 ul of the right construct into LB/Amp.  Shake 37 C overnight. Well Col PCR# Col PCR WellTarget Size (bp) Size (KD) Ext RE Sites Clone #PlasmidFull Name A71 SR4782389.53NdeI/XhoI121-23CSR478-21.1 B71 SR4782389.53NdeI/XhoI221-23CSR478-21.2 C73A2SR42337914.7NdeI/XhoI321-23CSR423-21.3 4 X

18. 18 Miniprep Day 8  Obtain archiving labels for the DNA and glycerol stock of the target set.  Make duplicate glycerol stock plates of the miniprep culture according to the archive SOP.  Spin to collect cell pellets.  Miniprep using Qiagen robot.  Archive DNA plates according to the archive SOP. Barcode?

19. 19 Transformation into expression cells Day 8-9  Mix 1 ul of miniprep DNA with Magik competent cells on ice.  Heat shock 42 C 1 min.  Plate on 24-well LB/Amp/Kan/Glucose plates.  Incubate overnight at 37 C. 8 X 24-well platesMiniprep DNA

20. 20 Small scale expression and inductions (1) Day 9-11  Inoculate 1 colony from the Magik transformation plate into 0.5 ml LB/Amp/Kan/Glucose.  Shake 6 hr 37 C.  Make glycerol stock plate of the culture according to the archive SOP.  Inoculate 0.5 ml MJ9 media  Shake overnight at 37 C. 2 Xcolonies

21. 21 Small scale expression and inductions (2) Day 9-11  Read OD600 of the overnight MJ9 culture. Select a few wells and dilute 1:10.  Inoculate 2 ml MJ9 with the overnight culture so that the staring OD600 is 0.1 to 0.2..  Grow at 37 C until OD600 reaches 0.5 to 0.7.  Induce with IPTG  Shake overnight at 17 C. 2 X8 X

22. 22 Expression protein sample preparations Day 11  Spin plates to collect cell pellets.  Add Lysis buffer to resuspend cells and keep on ice.  Sonicate for 40 min.  Save sonicated TOTAL lysate sample (T).  Spin to collect SUPERNATANT sample (S).  Add protein gel loading buffer to the samples. 2 X (T) s +(S) s = 384 samples

23. 23 SDS-PAGE gels Day 12-13 Gel #261Gel #262 LaneWellTarget NameMWExpressionSolubility Competition analysis 1---MW Ladder--- 2A7SR478-21.19.5 3B7SR478-21.29.5 4C7SR423-21.314.7 5D7SR423-21.214.7 6E7Size? 7F7SR501-21.115.0 8G7SR417-21.114.7 9H7SR417-21.214.7 10A8SR461-21.19.9 11B8SR461-21.29.9 12C8SR452-21.114.8

24. 24 SDS-PAGE gels Day 12-13  Heat samples at 72 C for 10 min.  Run samples on SDS-PAGE gels.  Wash and stain gels.  De-stain gels.  Take gel pictures/scan. 384 samples36SDS-PAGE gels 96-well Ni-NTA plate?

25. 25 Data Management Overview  Analyze SDS-PAGE gels, score expression and solubility.  Enter data into Excel worksheet.  Verify that all the wet reagents are archived.  Upload cloned constructs and small scale expression data into SPiNE.  Perform competition analysis.  Transfer to fermentation.

26. 26 Gel #261Gel #262 LaneWellTarget NameMWExpressionSolubility Competition analysis 1---MW Ladder--- 2A7SR478-21.19.555 3B7SR478-21.29.555 4C7SR423-21.314.743 5D7SR423-21.214.743 6E7Size? 7F7SR501-21.115.03.5 0 8G7SR417-21.114.722 9H7SR417-21.214.722 Expression and Solubility Scores Gel picture storage

27. 27 Spine construct upload TARGET NEW ENTR YResearcher INSERT TYPEVECTORTAG N-Tag Sequence C-Tag SequenceCLONED ON ER229 -15.1Dongyan WangFull ProteinpET15N-HexHismghhhhhhsh 8/30/2005 ER229 -15.2Dongyan WangFull ProteinpET15N-HexHismghhhhhhsh 8/30/2005 ER228A -15.1Dongyan WangSubsequencepET15N-HexHismghhhhhhsh 8/30/2005

28. 28 Spine small scale expression upload TARGET NEW E N T R YResearcherExp.on HOST STRAIN Growth. TEMP Induct. TempMEDIA Expr. ScaleEXPRPHASE Solubility SR482- 21.1 -ss Dongyan Wang7/25/2005 BL21(DE3)+ Magic3717MJ9Analytical5 soluble+ inclusion5 SR482- 21.2 -ss Dongyan Wang7/25/2005 BL21(DE3)+ Magic3717MJ9Analytical5 soluble+ inclusion5 SR490- 21.1 -ss Dongyan Wang7/25/2005 BL21(DE3)+ Magic3717MJ9Analytical3 inclusion body0

29. 29 Gel #261Gel #262 LaneWellTarget NameMWExpressionSolubility Competition analysis 1---MW Ladder--- 2A7SR478-21.19.555selected 3B7SR478-21.29.555 selected 4C7SR423-21.314.743purified 5D7SR423-21.214.743 purified 6E7Size? 7F7SR501-21.115.03.5 0 8G7SR417-21.114.722cloned 9H7SR417-21.214.722 cloned 10A8SR461-21.19.933Crystallized 11B8SR461-21.29.900 12C8SR452-21.114.844PDB e-09 Competition analysis Link/Buttons

30. 30 Transfer to Fermentation  Enter into Excel worksheet the targets that satisfy the following criteria:  EXS >=8  No PDB/PDBH hits or E value >= 0.01.  Other criteria?  Transfer to fermentation Well Primer WellTarget Original Size (bp) Original Size (KD) Ext RE Sites Clone #PlasmidFull Name A7A4SR4782389.526667NdeI/XhoI121-23CSR478-21.1 C7B4SR42337914.69667NdeI/XhoI321-23CSR423-21.3 G7D4SR41737914.69667NdeI/XhoI121-23CSR417-21.1

31. 31 Target set statistics Example Set Result: Working Step# Failed#Success Selected096 PCR393 Cloning 291 Expression 1180 Solubility 1565 Low Solubility 1550 PDB Hit 545 Fermentation 45

32. 32 Summary of a target’s life in the NESG cloning pipeline

33. 33 Target Selected PCR success Cloned Clone #1Clone #2 Not cloned PCR failure Primers designed Target sequence Primer data  Ligation well  Ligation date  Transformation colony # Well locations & Clone # Col PCR gel pics Miniprep well locations Miniprep culture Archive locations PCR result, gel picture Data Recorded at Each Step Die Step Success

34. 34 Clone of target Expression failure Expressed InsolubleSoluble Low solubility High solubility E value <=0.01 E value >0.01 Fermentation Expression transformation results Expression date Archive locations SDS-PAGE gel setup SDS-PAGE gel pictures Gel scores Competition analysis results Fermentation list Data Recorded Die Step Success

35. 35 It would be nice to have in PLIM  Target data recorded at each working step.  Search by target name.  Statistics of target results.  Graphic tool to help working with 96-well plates.  Notes of problems during the processes  Link to archiving.  Buttons for PDB competition analysis (current e-mail search).