Download presentation
Presentation is loading. Please wait.
Published byMorgan Hines Modified over 8 years ago
2
AP Biology 2005-2006 Chapter 17. RNA Processing
3
AP Biology 2005-2006 Transcription -- another look The process of transcription includes many points of control when to start reading DNA where to start reading DNA where to stop reading DNA editing the mRNA protecting mRNA as it travels through cell
4
AP Biology 2005-2006 Primary transcript Processing mRNA protecting RNA from RNase in cytoplasm add 5’ cap add polyA tail remove introns AUGUGA
5
AP Biology 2005-2006 Protecting RNA 5’ cap added G trinucleoside (G-P-P-P) protects mRNA from RNase (hydrolytic enzymes) 3’ poly-A tail added 50-250 A’s protects mRNA from RNase (hydrolytic enzymes) helps export of RNA from nucleus UTR
6
AP Biology 2005-2006 Dicing & splicing mRNA Pre-mRNA mRNA edit out introns intervening sequences splice together exons expressed sequences In higher eukaryotes 90% or more of gene can be intron no one knows why…yet there’s a Nobel prize waiting… “ AVERAGE ”… “ gene ” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “ JUNK ” !
7
AP Biology 2005-2006 Discovery of Split genes 1977 | 1993 Richard RobertsPhilip Sharp NE BioLabsMIT adenovirus common cold Discovered that the sequence of DNA Nucleotides that code for a polypeptide is usually split into segments (introns & exons)
8
AP Biology 2005-2006 snRNPs small nuclear RNA RNA + proteins Spliceosome several snRNPs recognize splice site sequence cut & paste RNA as ribozyme some mRNA can splice itself RNA as enzyme Splicing enzymes
9
AP Biology 2005-2006 Ribozyme RNA as enzyme Sidney AltmanThomas Cech 1982 | 1989 YaleU of Colorado
10
AP Biology 2005-2006 Splicing details No room for mistakes! (Mistakes – Mutation) editing & splicing must be exactly accurate a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|
11
AP Biology 2005-2006 3 bases on mRNA are called Codons. Each codon specifies and amino acid. AUG is a start codon 3 stop codons Code is redundant several codons for each amino acid *What’s the value in redundancy in the genetic code? Universal code
12
AP Biology 2005-2006 Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Hard to define a gene!
13
AP Biology Value of Alternative splicing? Allows a small number of genes to make many different proteins. 2005-2006
14
AP Biology 2005-2006 Domains (Gene can include many exons!) Modular architecture of many proteins separate functional & structural regions coded by different exons in same “gene”
15
AP Biology 2005-2006 AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit (a gene +) transcriptional unit TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' UTR exons enhancer 1000 + b
16
AP Biology cDNA (Complementary DNA) http://highered.mcgraw- hill.com/olc/dl/120078/bio_h.swf http://highered.mcgraw- hill.com/olc/dl/120078/bio_h.swf 2005-2006
17
AP Biology 2005-2006 Any Questions??
18
AP Biology 2005-2006 20-30b 3' introns The Transcriptional unit transcriptional unit TACACT DNATATA 5' RNA polymerase 5'3' 5'3' exons enhancer 1000 + b
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.