2. AP Biology 2005-2006 Chapter 17. RNA Processing

3. AP Biology 2005-2006 Transcription -- another look The process of transcription includes many points of control  when to start reading DNA  where to start reading DNA  where to stop reading DNA  editing the mRNA  protecting mRNA as it travels through cell

4. AP Biology 2005-2006 Primary transcript Processing mRNA  protecting RNA from RNase in cytoplasm add 5’ cap add polyA tail  remove introns AUGUGA

5. AP Biology 2005-2006 Protecting RNA 5’ cap added  G trinucleoside (G-P-P-P)  protects mRNA from RNase (hydrolytic enzymes) 3’ poly-A tail added  50-250 A’s  protects mRNA from RNase (hydrolytic enzymes)  helps export of RNA from nucleus UTR

6. AP Biology 2005-2006 Dicing & splicing mRNA Pre-mRNA  mRNA  edit out introns intervening sequences  splice together exons expressed sequences  In higher eukaryotes 90% or more of gene can be intron no one knows why…yet  there’s a Nobel prize waiting… “ AVERAGE ”… “ gene ” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “ JUNK ” !

7. AP Biology 2005-2006 Discovery of Split genes 1977 | 1993 Richard RobertsPhilip Sharp NE BioLabsMIT adenovirus common cold Discovered that the sequence of DNA Nucleotides that code for a polypeptide is usually split into segments (introns & exons)

8. AP Biology 2005-2006 snRNPs  small nuclear RNA  RNA + proteins Spliceosome  several snRNPs  recognize splice site sequence cut & paste RNA as ribozyme  some mRNA can splice itself  RNA as enzyme Splicing enzymes

9. AP Biology 2005-2006 Ribozyme RNA as enzyme Sidney AltmanThomas Cech 1982 | 1989 YaleU of Colorado

10. AP Biology 2005-2006 Splicing details No room for mistakes! (Mistakes – Mutation)  editing & splicing must be exactly accurate  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

11. AP Biology 2005-2006 3 bases on mRNA are called Codons. Each codon specifies and amino acid. AUG is a start codon 3 stop codons Code is redundant  several codons for each amino acid *What’s the value in redundancy in the genetic code? Universal code

12. AP Biology 2005-2006 Alternative splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons Hard to define a gene!

13. AP Biology Value of Alternative splicing? Allows a small number of genes to make many different proteins. 2005-2006

14. AP Biology 2005-2006 Domains (Gene can include many exons!) Modular architecture of many proteins  separate functional & structural regions  coded by different exons in same “gene”

15. AP Biology 2005-2006 AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit (a gene +) transcriptional unit TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' UTR exons enhancer 1000 + b

16. AP Biology cDNA (Complementary DNA) http://highered.mcgraw- hill.com/olc/dl/120078/bio_h.swf http://highered.mcgraw- hill.com/olc/dl/120078/bio_h.swf 2005-2006

17. AP Biology 2005-2006 Any Questions??

18. AP Biology 2005-2006 20-30b 3' introns The Transcriptional unit transcriptional unit TACACT DNATATA 5' RNA polymerase 5'3' 5'3' exons enhancer 1000 + b