Introduction to Oligonucleotide Microarray Technology

Slides:

Advertisements

Similar presentations

Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.

Advertisements

Modeling sequence dependence of microarray probe signals Li Zhang Department of Biostatistics and Applied Mathematics MD Anderson Cancer Center.

Introduction to Microarray

Introduction to DNA Microarray Technology Steen Knudsen, April 2005.

DNA microarray and array data analysis

DNA Microarray: A Recombinant DNA Method. Basic Steps to Microarray: Obtain cells with genes that are needed for analysis. Isolate the mRNA using extraction.

Additional Powerful Molecular Techniques Synthesis of cDNA (complimentary DNA) Polymerase Chain Reaction (PCR) Microarray analysis Link to Gene Therapy.

Class 6 DNA Arrays BIOMEMS, Fall Content u Polymerase Chain Reaction or PCR u DNA Detection Process u DNA Micro Arrays u Electronic DNA Arrays u.

The Human Genome Project and ~ 100 other genome projects:

Central Dogma 2 Transcription mRNA Information stored In Gene (DNA) Translation Protein Transcription Reverse Transcription SELF-REPAIRING ARABIDOPSIS,

Bacterial Physiology (Micr430)

Microarray Technology Types Normalization Microarray Technology Microarray: –New Technology (first paper: 1995) Allows study of thousands of genes at.

Class 7 DNA and Protein Arrays BIOMEMS, Winter 2009.

RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.

5 µm Millions of copies of a specific oligonucleotide probe >5 760,000 different complementary probes ~ targets Single stranded, labeled ‘target’

Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.

Arrays: Narrower terms include bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, gene arrays, gene.

Inferring the nature of the gene network connectivity Dynamic modeling of gene expression data Neal S. Holter, Amos Maritan, Marek Cieplak, Nina V. Fedoroff,

Microarrays: Theory and Application By Rich Jenkins MS Student of Zoo4670/5670 Year 2004.

Introduce to Microarray

Gene Expression BMI 731 Winter 2005 Catalin Barbacioru Department of Biomedical Informatics Ohio State University.

Introduction to DNA microarrays DTU - January Hanne Jarmer.

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

GeneChips and Microarray Expression Data

Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.

and analysis of gene transcription

By Moayed al Suleiman Suleiman al borican Ahmad al Ahmadi

with an emphasis on DNA microarrays

Affymetrix vs. glass slide based arrays

DNA microarrays Each spot contains a picomole of a DNA ( moles) sequence.

Lecture 22 Introduction to Microarray

Data Type 1: Microarrays

Microarray Technology

Introduction to DNA microarrays DTU - May Hanne Jarmer.

Technology for Systems Biology. Nucleic Acid Hybridization In principle complementary strands will associate Chemistry is quite different on surfaces.

Scenario 6 Distinguishing different types of leukemia to target treatment.

Microarrays and Gene Expression Analysis. 2 Gene Expression Data Microarray experiments Applications Data analysis Gene Expression Databases.

Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits)

Genomics I: The Transcriptome

GeneChip® Probe Arrays

Gene expression. The information encoded in a gene is converted into a protein  The genetic information is made available to the cell Phases of gene.

MICROARRAY TECHNOLOGY

Introduction to Microarrays.

Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.

Microarray Technology. Introduction Introduction –Microarrays are extremely powerful ways to analyze gene expression. –Using a microarray, it is possible.

Microarray (Gene Expression) DNA microarrays is a technology that can be used to measure changes in expression levels or to detect SNiPs Microarrays differ.

Introduction to Microarrays. The Central Dogma.

Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Microarrays and Other High-Throughput Methods BMI/CS 576 Colin Dewey Fall 2010.

EE150a – Genomic Signal and Information Processing On DNA Microarrays Technology October 12, 2004.

DNA Microarray Overview and Application. Table of Contents Section One : Introduction Section Two : Microarray Technique Section Three : Types of DNA.

Example of a DNA array used to study gene expression (note green, yellow red colors; also note.

Transcriptome What is it - genome wide transcript abundance How do you obtain it - Arrays + MPSS What do you do with it when you have it - ?

Microarray: An Introduction

Green with envy?? Jelly fish “GFP” Transformed vertebrates.

Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.

The Central Dogma. Life - a recipe for making proteins DNA protein RNA Translation Transcription.

The Basics of cDNA Microarray Technology

DNA Transcription.

Dr T-J’s Minilecture Chapter 12.

Example of a DNA Array (note green, yellow red colors; also note that only part of the total array is depicted)

Introduction to cDNA Microarray Technology

DNA Technology.

The Basics of Microarray Image Processing

DNA Transcription.

Introduction to Microarrays.

Data Type 1: Microarrays

Presentation transcript:

Introduction to Oligonucleotide Microarray Technology 1/11/2011 Copyright © 2011 Dan Nettleton

Oligonucleotides An oligonucleotide is a short sequence of nucleotides. (oligonucleotide=oligo for short) An oligonucleotide microarray is a microarray whose probes consist of synthetically created DNA oligonucleotides. Probes sequences are chosen to have good and relatively uniform hybridization characteristics. A probe is chosen to match a portion of its target mRNA transcript that is unique to that sequence. Oligo probes can distinguish among multiple mRNA transcripts with similar sequences.

Simplified Example ... ... ... ... gene 1 oligo probe for gene 1 ATTACTAAGCATAGATTGCCGTATA oligo probe for gene 1 ... gene 2 ... GCGTATGGCATGCCCGGTAAACTGG oligo probe for gene 2 shared blue regions indicate high degree of sequence similarity throughout much of the transcript

Oligo Microarray Fabrication Oligos can be synthesized and stored in solution for spotting as is done with cDNA microarrays. Oligo sequences can be synthesized on a slide or chip using various commercial technologies. In one approach, sequences are synthesized on a slide using ink-jet technology similar to that used in color printers. Separate cartridges for the four bases (A, C, G, T) are used to build nucleotides on a slide. The company Affymetrix uses a photolithographic approach which we will describe briefly.

Affymetrix GeneChips Affymetrix (www.affymetrix.com) is a company that manufactures GeneChips. GeneChips are oligonucleotide arrays. Each gene (more accurately sequence of interest or feature) is represented by multiple short (25-nucleotide) oligo probes. Some GeneChips include probes for around 60,000 genes. mRNA that has been extracted from a biological sample can be labeled (dyed) and hybridized to a GeneChip in a manner similar to that described for cDNA microarrays. Only one sample is hybridized to each GeneChip rather than two as in the case of cDNA microarrays.

Affymetrix Probe Sets A probe set is used to measure mRNA levels of a single gene. Each probe set consists of multiple probe cells. Each probe cell contains millions of copies of one oligo. Each oligo is intended to be 25 nucleotides in length. Probe cells in a probe set are arranged in probe pairs. Each probe pair contains a perfect match (PM) probe cell and a mismatch (MM) probe cell. A PM oligo perfectly matches part of a gene sequence. A MM oligo is identical to a PM oligo except that the middle nucleotide (13th of 25) is intentionally replaced by its complementary nucleotide.

A Probe Set for Measuring Expression Level of a Particular Gene ...TGCAATGGGTCAGAAGGACTCCTATGTGCCT... gene sequence AATGGGTCAGAAGGACTCCTATGTG perfect match sequence AATGGGTCAGAACGACTCCTATGTG mismatch sequence probe pair probe cell probe set

Different Probe Pairs Represent Different Parts of the Same Gene gene sequence Probes are selected to be specific to the target gene and have good hybridization characterictics.

Affymetrix’s Photolithographic Approach mask mask mask mask mask mask mask A C T mask T G C A A GeneChip

Source: www.affymetrix.com

Source: www.affymetrix.com

Source: www.affymetrix.com

Obtaining Labeled Target RNA  single strand cDNA single strand cDNA  double strand cDNA double strand cDNA  labeled single strand cRNA complementary to coding sequence Number of copies of each sequence gets amplified in conversion to cRNA.

Image from Hybridized GeneChip Source: www.affymetrix.com