Plants and algae Fungi Metazoa Protist Supplementary Figure 1. Phylogenetic analysis of GlsA1/ZRF orthologs in different organisms. Coloured background.

Slides:

Advertisements

Similar presentations

At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.

Advertisements

Meristem organization

Enzyme activity (μmol mg protein-1 min -1 ) DAA Xu-142 Xu-142 fl mutant CIN VIN CWIN (C) Supplemental Figure 1 Control.

Supplemental Figure 1. The wxr3 mutant exhibits decreased expression of CYCB1;1, SCR and SHR compared with the control. A and B, Expression of ProCYCB1;1:GUS.

Figure S1. Alignment of identified AtMYB93/92/53 homologues in land plants, used to infer the phylogeny in Figure 1B. Supporting information Figs S1-S7.

Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.

AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p.

The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

ATG AREB1 (At1g45249) AREB2 (At3g19290) ABF3 (At4g34000) ABF1 (At1g49720) No treatmentABA, 6h Chr. 1 areb1 (SALK_002984) // Chr. 3 Chr. 4 abf1-2 (SALK_132819)

Supplemental Figure 1. The cell death phenotype of fhy3 far1 double mutants. A. The cell death phenotype of fhy3-4 far1-2 mutant plants under LD conditions.

HKT1 form Arabidopsis relative extremophile Thellungiella work as Na/K co-transporter.

Figure S1. Co-expression network for MNM1: Shown is the co-expression network obtained from the ATTED-II database using MNM1 as a bait gene. The red dots.

NAC Family Genes AT1G01720 AT1G77450

Supplemental Fig. S1 A B AtMYBS aa AtMYBS

Supplemental Figure 1 A) B) C)

Volume 6, Issue 4, Pages (October 2000)

The Mitochondrion-Targeted PENTATRICOPEPTIDE REPEAT78 Protein Is Required for nad5 Mature mRNA Stability and Seed Development in Maize Ya-Feng Zhang,

John F. Golz, Emma J. Keck, Andrew Hudson Current Biology

Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis

Volume 10, Issue 3, Pages (March 2017)

Volume 4, Issue 2, Pages (March 2011)

Volume 9, Issue 8, Pages (August 2016)

MicroRNA Regulation of NAC-Domain Targets Is Required for Proper Formation and Separation of Adjacent Embryonic, Vegetative, and Floral Organs Allison.

Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development Jinye Mu,

Volume 2, Issue 1, Pages (January 2009)

Volume 5, Issue 2, Pages (March 2012)

Volume 7, Issue 5, Pages (May 2014)

MiR156-Regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, Detlef Weigel

Luo Chongyuan , Durgin Brittany G. , Watanabe Naohide , Lam Eric

Takatoshi Kiba, Kentaro Takei, Mikiko Kojima, Hitoshi Sakakibara

John F. Golz, Emma J. Keck, Andrew Hudson Current Biology

PXY, a Receptor-like Kinase Essential for Maintaining Polarity during Plant Vascular- Tissue Development Kate Fisher, Simon Turner Current Biology Volume.

Heat Shock Factor Protein Family of Transcription Factors

Bojan Gujas, Carlos Alonso-Blanco, Christian S. Hardtke

Volume 9, Issue 11, Pages (November 2016)

Liyuan Chen, Anne Bernhardt, JooHyun Lee, Hanjo Hellmann

Volume 2, Issue 4, Pages (July 2009)

Volume 11, Issue 8, Pages (May 2015)

Volume 7, Issue 9, Pages (September 2014)

Volume 7, Issue 1, Pages (January 2014)

Expression of a microRNA-Resistant Target Transgene Misrepresents the Functional Significance of the Endogenous microRNA: Target Gene Relationship Junyan.

Volume 13, Issue 16, Pages (August 2003)

Volume 26, Issue 1, Pages (January 2016)

The PHANTASTICA Gene Encodes a MYB Transcription Factor Involved in Growth and Dorsoventrality of Lateral Organs in Antirrhinum Richard Waites, Harinee.

Volume 5, Issue 4, Pages (July 2012)

Volume 8, Issue 7, Pages (July 2015)

The Arabidopsis Transcription Factor AtTCP15 Regulates Endoreduplication by Modulating Expression of Key Cell-cycle Genes Li Zi-Yu , Li Bin , Dong Ai-Wu.

Mutants for UVH6 and MED14 are impaired in heat stress–induced release of silencing. Mutants for UVH6 and MED14 are impaired in heat stress–induced release.

Volume 4, Issue 4, Pages (July 2011)

The Balance between CONSTANS and TEMPRANILLO Activities Determines FT Expression to Trigger Flowering Cristina Castillejo, Soraya Pelaz Current Biology

Identification of the uvh6-4 mutation.

Volume 9, Issue 8, Pages (August 2016)

Volume 5, Issue 6, Pages (November 2012)

Volume 26, Issue 7, Pages (April 2016)

PtrHB7, a class III HD-Zip Gene, Plays a Critical Role in Regulation of Vascular Cambium Differentiation in Populus Yingying Zhu, Dongliang Song, Jiayan.

Phenotypes of Arabidopsis msc mutants.

BRI1 signaling at the dividing cells restores overall root growth

Volume 7, Issue 8, Pages (August 2014)

7 WT 6 irx1-6 ixr fold increased expression 3 2 n- 1 AT1G18710

Volume 2, Issue 1, Pages (January 2009)

Arabidopsis RPA2: A Genetic Link among Transcriptional Gene Silencing, DNA Repair, and DNA Replication Taline Elmayan, Florence Proux, Hervé Vaucheret

Influence of RdDM on DCL4 Transcript Isoform Expression.

Volume 7, Issue 7, Pages (July 2014)

Wang Long , Mai Yan-Xia , Zhang Yan-Chun , Luo Qian , Yang Hong-Quan

CCA1 Binds the Promoter of GI in Vitro and in Vivo.

The bHLH Transcription Factors MYC2, MYC3, and MYC4 Are Required for Jasmonate- Mediated Inhibition of Flowering in Arabidopsis Houping Wang, Yang Li,

Volume 4, Issue 2, Pages (March 2011)

Volume 7, Issue 12, Pages (December 2014)

Presentation transcript:

Plants and algae Fungi Metazoa Protist Supplementary Figure 1. Phylogenetic analysis of GlsA1/ZRF orthologs in different organisms. Coloured background indicates different groups of organisms: blue-plants and algae, pink-fungi and green- metazoa. A. thaliana GlsA sequences are indicated by red boxes and the A. tequilana GlsA sequence by a green box. Accession numbers of sequences used in phylogenetic analysis are listed in Supplementary Table 1.

(a) (b) Supplementary Figure 2. Expression levels of AtglsA1 and AtGlsA2 under stress conditions. (a) AtglsA1 and AtGlsA2 absolute mRNA expression levels in heat stressed shoots (b) AtglsA1 and AtGlsA2 absolute mRNA expression levels in cold stressed shoots Data were extracted from public expression arrays: (

100pb ZUO1 DNAJ SANT AtGlsA1 (At3G11450) AtGlsA2 (At5G06110) atglsa1-3 atglsa 2-1 atglsa1-1 atglsa1-2 atglsa2-2 ba cd Act2 c d a b atglsa1-2atglsa1-3atglsa2-1atglsa2-2atglsa1-1Wild type A B Supplementary Figure 3. Characterization of A. thaliana GlsA insertion mutants. A. Representation of the structure of AtGlsA1 and AtGlsA2 loci. Known protein domains are color coded as indicated in the key. Triangles indicate T-DNA insertion sites. B. Semiquantitative RT-PCR analysis of 9-day-old A. thaliana seedlings. Genotypes are shown above each lane and amplified regions denoted a-d as shown in Figure 4A are indicated to the left of each gel fragment. Act2-Actin control.

Wild type atglsa1-3 atglsa2-1 atglsa1-3 atglsa2-1 7 week old plants g e f h a b c d Supplementary Figure 4. Morphologies of atglsa1-3 atglsa2-1 in aerial tissues. a. Wild type (left) and atglsa1-3 atglsa2-1 (right) Scale bar: 5cm. b. Detail of atglsa1-3 atglsa2-1 showing multiple ectopic rosettes c. 7 week old atglsa1-3 atglsa2-1 showing short inflorescences. Scale bars: 1cm. d. Wild type (left) and atglsa1-3 atglsa2-1 (right) inflorescences of 7 week old plants, scale bar 2cm. e, f wild type siliques, g, h atglsa1-3 atglsa2-1 siliques, scale bars are 0.5 mm.

(c) (d) (e) (f) (g) (h) (a) (b) Supplementary Figure 5. Phenotype confirmation of atglsa1 atglsa2 double mutants. a-d-12 day old plants, e-h-7 week old plants, a and e-wild type, b and f-atglsa1-2 atglsa2-2, c and g-atglsa1-1 atglsa2-2, d and h-atglsa1-3 atglsa2-1. Scale bars in b and c are 0.5mm, in a and d, 1mm.

WT atglsa1-3 atglsa2-1 Supplementary Figure 6. qRT-PCR analysis of stem cell identity and differentiation marker genes in 6 day old plants of the atglas1-3 atglsa2-1 mutant relative to the Wild type (WT). WUS-WUSCHEL, CLV3- CLAVATA3, AS1-ASYMETRIC LEAVES1, RBR-RETINOBLASTOMA, SCR-SCARECROW, STM- SHOOTMERISTEMLESS, BP-BREVIPEDICELLUS. The data represent the average of two biological replicates and three technical replicates, error bars represent standard deviation.