EFFECTS OF THE TESTICULAR ENVIRONMENT ON DEVELOPING MICE PRIMORDIAL GAMETOCYTES AND ITS INFLUENCE ON GENETIC IMPRINTING Project Summary: Much information is lacking about the process of genetic imprinting in the testicular environment. This proposal will examine the effects of imprinting within a testicular environment and whether the imprint is a result of the cell maturing there. To study this, primordial oocycte nuclei will be transplanted into enucleated primordial spermatocytes and placed into the testicular environment by injection into the efferent ducts. Maturing germ cells will be collected throughout the experiment to study the methylated state of the Insulin-Like Growth Factor 2 (ILGF2) loci using a new technique of Methylation Specific PCR (MSPCR.) Results will then be studied to determine if the testicular environment significantly influences the genetic imprint found at the ILGF2 site. If the testicular environment influences the paternal imprint, studies can then concentrate on this environment to further investigate the mechanisms of genetic imprinting and the conditions involved. Introduction: Environmental signaling has been shown to influence cell functions regulated by gene sequences acquired from both parents. Mendelian genetics specifies dominance rules for these alleles; however, maternal and paternal alleles may not always be physically expressible. For example, inherited methylated genes (imprints) are not expressible, regardless of their dominance. This experiment will test the influencing factors over one of these methylated alleles and whether the imprinted gene can be changed. This will mark the beginning of our understanding for environmental control over imprinting. Research Design and Methods: Homozygous mutant infertile sertoli cell only (SCO) ♂ mice and fertile normal ♂ and ♀ mice will be acquired from Jackson Laboratory. A collection of primordial germ cells will be obtained and enucleated from normal ♂ and ♀ mice. Pronuclei of the ♀ primordial germ cells will be inserted into the enucleated ♂ primordial germ cell, transplanted into a SCO ♂ testicular environment by injection into the efferent ducts, and allowed to mature for six months. These techniques will be performed using Eppendorf Micromanipulator TransferMan, CellTram Air, CellTram Oil or FemtoJet (Herman, et. al., 1996.) The controls and experimental groups will be designed as seen in Figure 1 below: Jim Weakley York College of Pennsylvania, Department of Biological Sciences Literature Citied Herman, J.G., Graff, J.R., Myohanen, S., Nelkin, B.D., Baylin, S.B Methylation- Specific PCR: A Novel PCR Assay for Methylation Status of CpG Islands. Medical Sciences V Kalthoff, K Analysis of Biological Development. 2 nd ed. McGraw-Hill Company, New York, NY. Ogawa, T., Dobrinski, I., Avarbock, M.R., Brinster, R.L Transplantation of Male Germ Line Stem Cells Restores Fertility in Infertile Mice. V6: Sanford, J.P., Clark, H.J., Chapman, V.M., Rossant, J Differences in DNA Methylation During Oogenesis and Spermatogenesis and Their Persistance during Early Embryogenesis in the Mouse. Genes and Development V1: Research Design and Methods cont. Gametes collected from the cauda of the recipient SCO ♂ will be purified (by CsCl ethidium bromide gradient centrifugation in accordance to Sanford, et. al protocol.) A CpGenome ™ DNA Modification Kit (with sodium bisulfite) (MSPCR) will be used following the manufactures (Oncor, Inc.) instructions where all unmethylated cytosines will convert to uracil while methylated cytosines remain unchanged (Figure 2.) Primer sequences (obtained from NCBI) for ILGF2 gene (5 ’ tacttattcaaaatataacc3 ’ and 5 ’ cccaaactcaaaaaaaataa3 ’ -unmethylated sequence [Primer A]) will be used for half the mixture while primer sequences (5 ’ tacttgttcgaaatgtagcc3 ’ and 5 ’ cccaggctcggaggaagtga3 ’ - methylated sequence [Primer B]) will be used for the remaining. PCR products from each of the four groups will be electrophoresed (Figure 3.) Objectives: Determine the methylation state of the maternal DNA on the ILGF2 loci placed in a testicular environment. Determine whether genetic imprints result from their environment or a predetermined state. Review of Literature: Pronuclear transplantation experiments indicate that maternal and paternal alleles are both needed for embryonic development and have different activation states controlled by the methylation of their CpG islands (imprinting.) (Kalthoff, 2001) (Table 1) Recent cloning experiments have produced developing embryos with supporting tissue, suggesting these active and inactive alleles are conserved throughout the organism ’ s life within their somatic cells (Kalthoff, 2001.) The insulin-like growth factor-2 (ILGF2) loci has been found methylated only within female gametes and only expressed on the paternal allele (Sanford, et. al., 1986.) Review of Literature cont. MSPCR is a new technique that allows researchers to differentiate between methylation states of CpG islands on any gene of interest (Herman, et. al., 1996.) It is hypothesized as primordial germ cells mature, their imprint is overwritten and methylated, reflecting the sex of the species. Environmental control over imprinting has not been examined, however, sertoli cell influence on spermatogenesis has clearly been shown to promote cell maturation and growth (Ogawa, et. al ) It is feasible to believe that sertoli cells may have the ability to influence or signal the methylation of certain genes. This proposal will use the techniques of MSPCR and transplantation of germ cells to determine whether the testicular environment affects the paternal imprint found on the ILGF2 loci. Table 1 Pronuclear Transplantation Experiments with Fertilized Mouse Eggs Expected Results: These results should demonstrate that neither cell nor nuclear transplantation influences ILGF2 imprinting. These results should also demonstrate whether the testicular environment can impose a ‘ male ’ ILGF2 imprint on a female genome or if the genetic imprint is predetermined. Future studies may further clarify whether imprinting is influenced by the tissue matrix itself or the cytoplasm of the host cell. Figure 2: CpGenome Modification will convert all unmethylated cytosines to uracil; methylated cytosines will remain unchanged. Figure 3: Group 1 (control) should reveal a ‘female’ ILGF2 imprint. In contrast, Groups 2, 3, and 4 should reveal a ‘male’ ILGF2 imprint. Controls: DNA Cell/DNA After Cell/DNA After Experimental: Transplantation Extraction ♀ ♂ ♂ ♂ ♂ ♂ ♀ ♂ ♀ Imprint ♂ ♂ ♀ ♂ Imprint ♂ Imprint ♂ Imprint Figure 1: Experimental design Blue color indicates Female Red color indicates Male Symbols (♀ ♂) indicate DNA Circles indicate primordial germ cells (Kalthoff, 2001) G 1800bp 1234 AAAABBBB A- Unmethylated Primer Sequence used B- Methylated Primer Sequence used MW 0bp