Moderní metody analýzy genomu - analýza Mgr. Nikola Tom Brno, 2.4.2014.

Slides:

Advertisements

Similar presentations

Differentially expressed genes Sample class prediction etc.

Advertisements

Processing of miRNA samples and primary data analysis

ChIP-seq analysis Ecole de bioinformatique AVIESAN – Roscoff, Jan 2013.

DNAseq analysis Bioinformatics Analysis Team

Getting the computer setup Follow directions on handout to login to server. Type “qsub -I” to get a compute node. The data you will be using is stored.

SOLiD Sequencing & Data

Peter Tsai Bioinformatics Institute, University of Auckland

RNA-seq Analysis in Galaxy

Diseño Experimental y Controles de Calidad

Biological Sequence Analysis BNFO 691/602 Spring 2014 Mark Reimers

NGS data format and General Quality Control. Data format “Flowchart” Sequencer raw data FastqSAM/BAM.

NGS Analysis Using Galaxy

Next generation sequencing Xusheng Wang 4/29/2010.

Whole Exome Sequencing for Variant Discovery and Prioritisation

Mapping NGS sequences to a reference genome. Why? Resequencing studies (DNA) – Structural variation – SNP identification RNAseq – Mapping transcripts.

Expression Analysis of RNA-seq Data

Bioinformatics and OMICs Group Meeting REFERENCE GUIDED RNA SEQUENCING.

Introduction to next generation sequencing Rolf Sommer Kaas.

RNAseq analyses -- methods

June 11, 2013 Intro to Bioinformatics – Assembling a Transcriptome Tom Doak Carrie Ganote National Center for Genome Analysis Support.

Experimental validation. Integration of transcriptome and genome sequencing uncovers functional variation in human populations Tuuli Lappalainen et al.

Next Generation DNA Sequencing

Transcriptome Analysis

RNA-Seq in Galaxy Igor Makunin QAAFI, Internal Workshop, April 17, 2015.

The iPlant Collaborative Community Cyberinfrastructure for Life Science Tools and Services Workshop RNA-Seq using the Discovery Environment And COGE.

Introduction To Next Generation Sequencing (NGS) Data Analysis

NIH Extracellular RNA Communication Consortium 2 nd Investigators’ Meeting May 19 th, 2014 Sai Lakshmi Subramanian – (Primary

Quick introduction to genomic file types Preliminary quality control (lab)

Alexis DereeperCIBA courses – Brasil 2011 Detection and analysis of SNP polymorphisms.

BRUDNO LAB: A WHIRLWIND TOUR Marc Fiume Department of Computer Science University of Toronto.

 Read quality  Adaptor trimming  Read sequence collapse Preprocessing Genome mapping  Map read to the spruce genome (Pabies1.0- genome.fa) using Patman

Introductory RNA-seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis.

RNA-Seq Primer Understanding the RNA-Seq evidence tracks on the GEP UCSC Genome Browser Wilson Leung08/2014.

RNA-Seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis is doing the.

Introduction to RNAseq

SMARTAR: small RNA transcriptome analyzer Geuvadis RNA analysis meeting April 16 th 2012 Esther Lizano and Marc Friedländer Xavier Estivill lab Programme.

No reference available

RNA-Seq in Galaxy Igor Makunin DI/TRI, March 9, 2015.

Short read alignment BNFO 601. Short read alignment Input: –Reads: short DNA sequences (upto a few hundred base pairs (bp)) produced by a sequencing machine.

Current Data And Future Analysis Thomas Wieland, Thomas Schwarzmayr and Tim M Strom Helmholtz Zentrum München Institute of Human Genetics Geneva, 16/04/12.

Personalized genomics

When the next-generation sequencing becomes the now- generation Lisa Zhang November 6th, 2012.

Canadian Bioinformatics Workshops

Reliable Identification of Genomic Variants from RNA-seq Data Robert Piskol, Gokul Ramaswami, Jin Billy Li PRESENTED BY GAYATHRI RAJAN VINEELA GANGALAPUDI.

What should a bioinformatician know about DNA sequencing, and why?

From Reads to Results Exome-seq analysis at CCBR

DAY 2. GETTING FAMILIAR WITH NGS SANGREA SHIM. INDEX  Day 2  Get familiar with NGS  Understanding of NGS raw read file  Quality issue  Alignment/Mapping.

Canadian Bioinformatics Workshops

NGS File formats Raw data from various vendors => various formats

Short Read Sequencing Analysis Workshop

Cancer Genomics Core Lab

RNA-Seq Green Line Overview

Moderní metody analýzy genomu

MGmapper A tool to map MetaGenomics data

Dr. Christoph W. Sensen und Dr. Jung Soh Trieste Course 2017

S1 Supporting information Bioinformatic workflow and quality of the metrics Number of slides: 10.

EMC Galaxy Course November 24-25, 2014

Transcriptome Assembly

Genome organization and Bioinformatics

ChIP-Seq Data Processing and QC

Maximize read usage through mapping strategies

ChIP-seq Robert J. Trumbly

Additional file 2: RNA-Seq data analysis pipeline

Canadian Bioinformatics Workshops

Sequence Analysis - RNA-Seq 2

BF528 - Sequence Analysis Fundamentals

RNA-Seq Data Analysis UND Genomics Core.

The Variant Call Format

Presentation transcript:

Moderní metody analýzy genomu - analýza Mgr. Nikola Tom Brno,

Workflow

Raw sequence = fastq Biological sequence Corresponding quality scores ASCII character (fasta+ qual, csfasta + csqual, SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%++)(%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

FastQC

Cutadapt Adaptor trimming (miRNA) Quality filtering Length filtering

Read mapping => SAM, BAM Usually mapping reads on reference miRNA - special case – Grouping and annotate against mirBase DNA – BWA, Bowtie, Bfast, SHRiMPclc RNA – TopHat (de novo splice aligner) Commercial – CLC Genomics Workbench

SAM

Alignment

Mapping, Coverage reports Important checkout for lab protocol Specificity of PCR Normalization Settings of variant calling threshold, CNV

SNV and small InDel Calling Coverage Frequency Base quality !!! Genomic context (homopolymers) Nucleotide type Position in read (errors at the read end) Alignment errors

CNV variations

Structural variations Mate-pair library Long InDel Translocation

Annotating and filtering Gene Transcript dbSNP Regulation Comparative genomics Repeats Functional Gene ontology miRNA targets Etc.