Biotechnology Methods of working with DNA started in the 1970s. A key accomplishment was the invention of techniques for making recombinant DNA- these are DNA molecules formed when segments from two different sources are combined.

DNA Cloning: An Overview Cell containing gene of interest Bacterium 1 Gene inserted into plasmid Bacterial chromosome Plasmid Gene of interest Recombinant DNA (plasmid) DNA of chromosome 2 2 Plasmid put into bacterial cell Scientists needed methods to isolate small portions of a chromosome. Cloning is used to study specific genes. Recombinant bacterium Gene cloning involves using bacteria to make multiple copies of a gene

Recombinant bacterium Fig. 20-2b Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Gene of Interest Protein expressed by gene of interest Copies of gene Protein harvested 4 Basic research and various applications Basic research on gene Basic research on protein Cloning is useful for 2 purposes: 1) to make many copies of a particular gene; and 2) to create a protein product. A protein with medical uses such as human growth hormone can be made in large quantities from cultures of bacteria carrying the cloned gene for the protein. Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

Restriction Enzymes Gene cloning was made possible by the discovery of restriction enzymes. Many different enzymes exist named after the organism in which they are found EcoRI (E. coli), HindIII (Haemophilus influenza), PstI (Providencia stuartii)

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-1 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-2 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA One possible combination

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-3 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA This is how DNA is inserted into plasmids One possible combination 3 DNA ligase seals strands. Recombinant DNA molecule

DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR Fig. 20-UN3 DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR Vector Cut by same restriction enzyme, mixed, and ligated A complete set of recombinant plasmids, each carrying copies of a particular segment from the initial genome can be stored as a genomic library. There are various other cloning systems, but this is really the general idea. Recombinant DNA plasmids

molecules; 2 molecules (in white boxes) match target sequence Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) 5 3 TECHNIQUE Target sequence Genomic DNA 3 5 PCR can make billions of a specific DNA segment in a few hours. 1 Denaturation 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleo- tides Cloning is great for large quantities of a particular gene. But PCR is much more sensitive and is able to make large quantities of smaller DNA fragments when the DNA is in very small quantities (like looking for a needle in a haystack) or when the DNA is impure. A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules. Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence

PCR produces many copies of a specific target segment of DNA The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA PCR Animation

PCR DNA Amplification

PCR Applications 30,000 y. o. woolly mammoth Devised in 1985, PCR has had a huge impact on biological research and technology. In forensics, PCR requires only small samples of DNA to analyze

DNA polymerase (Taq) The key to PCR was the discovery of an unusual DNA polymerase isolated from a bacterium (Thermus acquaticus) living in hot springs- this enzyme could withstand the temperatures necessary to separate DNA at the beginning of the cycle.

Gel Electrophoresis One indirect method of rapidly Fig. 20-9 Mixture of DNA mol- ecules of different sizes Power source Longer molecules Shorter molecules Gel Anode Cathode TECHNIQUE RESULTS 1 2 + – Gel Electrophoresis One indirect method of rapidly analyzing and comparing genomes is gel electrophoresis Figure 20.9 Gel electrophoresis

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome In 1995, an entire bacterial genome was sequence – 1.8 milliion base pairs. A mere 12 years later, sequencing technology had advanced so far that the human genome was completed by 2007

DNA Sequencing Relatively short DNA fragments Fig. 20-12 DNA (template strand) TECHNIQUE RESULTS DNA (template strand) DNA polymerase Primer Deoxyribonucleotides Shortest Dideoxyribonucleotides (fluorescently tagged) Labeled strands Longest Shortest labeled strand Longest labeled strand Laser Direction of movement of strands Detector Last base of longest labeled strand Last base of shortest labeled strand dATP dCTP dTTP dGTP ddATP ddCTP ddTTP ddGTP DNA Sequencing Relatively short DNA fragments can be sequenced using the dideoxy chain termination method. Figure 20.12 Dideoxy chain termination method for sequencing DNA Sequencing Video

DNA Sequencing

DNA Sequencer

New approaches have accelerated the pace of genome sequencing The most ambitious mapping project to date has been the sequencing of the human genome Officially begun as the Human Genome Project in 1990, the sequencing was largely completed by 2003 The project had three stages: Genetic (or linkage) mapping; Physical mapping; DNA sequencing The Human Genome Project was proposed in 1986 to determine the normal sequence of all human DNA.

The history of sequencing New Generation Sequencing Millions of different fragments are sequenced at the same time. This is called massively parallel sequencing. It is fully automated and miniaturized. It is an inexpensive way to sequence large genomes.

Studying the Expression of Interacting Groups of Genes DNA microarray assays compare patterns of gene expression in different tissues, at different times, or under different conditions Microarray Video 50 µm Automation has allowed scientists to measure expression of thousands of genes at one time using DNA microarray assays

Genetic diversity is explored without isolating intact organisms. Metagenomics Genetic diversity is explored without isolating intact organisms. From: National Academy of Science, 2009

Cloning organisms has the potential to generate stem cells for research Organismal cloning produces one or more organisms genetically identical to the “parent” that donated the single cell

Can a differentiated plant cell develop into a whole plant? Fig. 20-16 EXPERIMENT Transverse section of carrot root 2-mg fragments Fragments were cultured in nu- trient medium; stirring caused single cells to shear off into the liquid. Single cells began to divide. Embryonic plant developed from a cultured single cell. Plantlet was cultured on agar medium and later, planted in soil. A single somatic carrot cell developed into a mature carrot plant. RESULTS Whole plants have been cloned from single differentiated cells since the 1950s In plants mature cells can de-differentiate and then give rise to all cell types. Any cell with this potential is called totipotent.

Can the nucleus from a differentiated animal cell direct development of an organism? Fig. 20-17 EXPERIMENT Less differ- entiated cell RESULTS Frog embryo Frog egg cell UV Donor nucleus trans- planted Frog tadpole Enucleated egg cell Egg with donor nucleus activated to begin development Fully differ- entiated (intestinal) cell Donor nucleus trans- planted Most develop into tadpoles Most stop developing before tadpole stage Experiments with frog embryos have shown that a transplanted nucleus can often support normal development of the egg Would you infer that differentiated animal cells are totipotent? (NO!)

Reproductive cloning of a mammal by nuclear transplantation TECHNIQUE Mammary cell donor RESULTS Surrogate mother Nucleus from mammary cell Cultured mammary cells Implanted in uterus of a third sheep Early embryo Nucleus removed Egg cell donor Embryonic development Lamb (“Dolly”) genetically identical to mammary cell donor Egg cell from ovary Cells fused Grown in culture 1 3 4 5 6 2 Reproductive cloning of a mammal by nuclear transplantation In 1997, Scottish researchers announced the birth of Dolly In 1997, Scottish researchers announced the birth of Dolly, a lamb cloned from an adult sheep by nuclear transplantation from a differentiated mammary cell Dolly’s premature death in 2003, as well as her arthritis, led to speculation that her cells were not as healthy as those of a normal sheep, possibly reflecting incomplete reprogramming of the original transplanted nucleus

CC (for Carbon Copy) was the first cat cloned Fig. 20-19 CC (for Carbon Copy) was the first cat cloned Since 1997, cloning has been demonstrated in many mammals, including mice, cats, cows, horses, mules, pigs, and dogs CC (for Carbon Copy) was the first cat cloned; however, CC differed somewhat from her female “parent

The practical applications of DNA technology Many fields benefit from DNA technology and genetic engineering

From bone marrow in this example Cultured stem cells Early human embryo at blastocyst stage (mammalian equiva- lent of blastula) Different culture conditions Different types of differentiated cells Blood cells Nerve cells Liver cells Cells generating all embryonic cell types Adult stem cells Cells generating some cell types Embryonic stem cells From bone marrow in this example A stem cell is a relatively unspecialized cell that can reproduce itself indefinitely and differentiate into specialized cells of one or more types Stem cells isolated from early embryos at the blastocyst stage are called embryonic stem cells; these are able to differentiate into all cell types. Can repair damaged or diseased organs. Stem cell animation Nuclear implantation

Gene therapy Cloned gene Fig. 20-22 Bone marrow Cloned gene Bone marrow cell from patient Insert RNA version of normal allele into retrovirus. Retrovirus capsid Viral RNA Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. Viral DNA carrying the normal allele inserts into chromosome. Inject engineered cells into patient. 1 2 3 4 Gene therapy Figure 20.22 Gene therapy using a retroviral vector Gene therapy holds great potential for treating disorders traceable to a single defective gene

Genetic engineering in plants has been used to transfer many Fig. 20-25 TECHNIQUE Genetic engineering in plants has been used to transfer many useful genes Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts T DNA RESULTS DNA with the gene of interest The Ti plasmid is the most commonly used vector for introducing new genes into plant cells Genetic engineering in plants has been used to transfer many useful genes including those for herbicide resistance, increased resistance to pests, increased resistance to salinity, and improved nutritional value of crops Recombinant Ti plasmid Plant with new trait

Plant Breeding compared to Genetic Modification of Plants

GHOSTS

Fig. 20-11 TECHNIQUE Heavy weight Restriction fragments DNA + restriction enzyme I II III Nitrocellulose membrane (blot) Gel Sponge I Normal -globin allele II Sickle-cell allele III Heterozygote Paper towels Alkaline solution 1 Preparation of restriction fragments 2 Gel electrophoresis 3 DNA transfer (blotting) Radioactively labeled probe for -globin gene Figure 20.11 Southern blotting of DNA fragments- this method combines gel electrophoresis with something called nucleic acid hybridization. Because there are too many bands to distinguish, scientists use a radioactive single stranded DNA complementary to the gene of interest. The probe will only recognize and bond with the gene of interest. Probe base-pairs with fragments I II III I II III Fragment from sickle-cell -globin allele Film over blot Fragment from normal -globin allele Nitrocellulose blot 4 Hybridization with radioactive probe 5 Probe detection