Monnat Lab progress monomerizations of Cre, Mso (Hui) 2 nd round designs vs. Anopheles targets (Umut) in vivo recombination reporter assays (Ray, Hui)

Slides:

Advertisements

Similar presentations

Monomerization of Homing Endonucleases Targets: CreI, MsoI, and CeuI. Goal: Generation of catalytically active monomeric HEs by connecting two copies of.

Advertisements

Directed Evolution of a Fungal Peroxidase Irene Woo Enzong Yap Joel R. Cherry et al.

Outline Questions from last lecture? P. 40 questions on Pax6 gene Mechanism of Transcription Activation –Transcription Regulatory elements Comparison between.

Gene technology - what is it? - what is it used for? - how does it work?

Selection of XID(Btk) site specific I-AniI variant for gene repair in hematopoietic stem cells Yupeng Wang Rawlings Lab Center for Immunity and Immunotherapy.

Recombinant DNA Technology

Protein-Protein Interaction Screens. Bacterial Two-Hybrid System selectable marker RNA polymerase DNA binding protein bait target sequence target.

Molecular Genetics Introduction to The Structures of DNA and RNA

Synthetic biology Genome engineering Chris Yellman, U. Texas CSSB.

Mammalian RNAi pathways Michael T. McManus MIT Center for Cancer Research.

Genetic Engineering Do you want a footer?.

Biotechnology DNA technology. Review Some of the most important techniques used in biotechnology involve making recombinant DNA molecules Recombinant.

Kyle Gribbin University of Oregon Mentor: Margarita Rojas PI: Alice Barkan.

Chapter 4 Molecular Cloning Methods. Gene Cloning The Role of Restriction Endonuclease.

Homology-directed gene repair Sequence correction xx exogenous repair substrate Rad51… sister chromatids I-SceI.

I. Selections: I-AniI for wild-type site binding/cleavage: “WT-opt” (Ryo) I-AniI towards hCF (Audrey) I-AniI towards A.gam. CTLMA2 (Ryo) II. Binding specificity.

Gene repair in murine hematopoietic stem cells (NGEC Component 6) Aim 1: Develop and test a murine X-linked severe combined immunodeficiency (XSCID) model.

Stoddard Lab Activities 1.Structural biology of design work: I-MsoI cluster designs vs. individual designs (Justin Ashworth and Greg Taylor) 2.Binding.

Gene repair in murine hematopoietic stem cells (NGEC Component 6) Aim 1: Develop murine X-linked severe combined immunodeficiency (XSCID) models for I-SceI.

Introduction to Biotechnology ~manipulating and analyzing DNA.

Different approaches: Site degeneracy data from libraries with randomized target sites (in vitro, complexity of the initial library is crucial, involves.

Functional testing in Ion Channel Arrhythmias

Stoddard Lab Immediate Goals (Nov-Dec 2007) Optimization of I-AniI wild-type site recognition/I-AniI stability and generation of in vivo activity (bacterial.

Recombinant DNA What is the basis of recombinant DNA technology? How does one “clone” a gene? How are genetically modified organisms (GMOs) created? Illustration.

GENETIC RECOMBINATION By Dr. Nessrin Ghazi AL-Abdallat Lecturer of Microbiology.

Jonathan Worrall MCB away day An appraisal of metals used in proteins Systematic survey of 1371 different enzymes with a known 3D structure.

Genetic Engineering Genetic engineering is also referred to as recombinant DNA technology – new combinations of genetic material are produced by artificially.

High-Throughput Cloning and Expression Library Creation for Functional Proteomics The International Proteomics Tutorial Program.

Hypoxia-inducible regulation of placental BOK expression by Daochun Luo, Isabella Caniggia, and Martin Post Biochem. J. Volume 461(3): August 1,

NGEC Applications Meeting Mike Certo Scharenberg Lab.

CH. 20 WARM-UP Share 3 things you are grateful for. Use your textbook (Ch. 20) to answer the following review questions. 1. What is recombinant DNA? 2.

Translational efficiency of Dengue Virus(DEN) and DEN variants in cells. Andrew Regan - Microbiology DREHER LAB - ALS1065.

SBI 4U December 2012 Manipulating & Cloning DNA. Introduction Insulin, diabetes and genetic engineering Genetic engineering: the intentional production.

nome/program.html.

Engineering magnetosomes to express novel proteins Which ones? Tweaking p18 Linker Deleting or replacing GFP Something else? TRZN Oxalate decarboxylases.

Aim #68: What are some applications of Genetic Engineering? Genetic Engineering is a process that is used to the alter the genetic instructions in organisms.

REVIEW OF MOLECULAR GENETICS DR. EDELBERG. Genes, DNA, & Chromosomes.

BIOTECHNOLOGY DNA Technology.

Cameron Mackereth Affinity based definition of RNA motifs and

Aim: What are some applications of Genetic Engineering?

Date: January 26th, 2017 Aim #44: What are some applications of genetic engineering? HW: Daily Review of Class Notes Biotechnology Textbook Homework.

                                  

Monomerization of Homing Endonucleases

The distribution and function of the Adenovirus L4-33K protein

HMGA2 is a SUMOylation target.

Mammalian RNAi pathways MIT Center for Cancer Research

Genetic Engineering and Gene Expression

Cell Surface Targeting: An Update.

Step 1: amplification and cloning procedures

5. Genetic Engineering Techniques

Vav‐1 gene‐targeting strategy.

In vivo optimization of the tagging approach using the Act5C model locus and flow cytometry-based quantification of the Act5C-GFP tagging success. In vivo.

AAV viral constructs and Rep expression plasmids.

High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia by.

Involvement of SR Proteins in mRNA Surveillance

Disruption of the BGLF2 gene decreased infectious progeny production.

Different Genes ~ Protein Primary Structure

Volume 7, Issue 1, Pages (April 2014)

XIST regulated miR-29c by directly targetting in TMZ-resistant glioma cells XIST regulated miR-29c by directly targetting in TMZ-resistant glioma cells.

HEPN1, a novel gene that is frequently down-regulated in hepatocellular carcinoma, suppresses cell growth and induces apoptosis in HepG2 cells Mei Chung.

Cas9/gRNA-mediated gene deficiency in DF-1 cells.

Relationship between Genotype and Phenotype

Cre-loxP-mediated chromosomal engineering in mice.

Figure 4 DNM1 mutations affect protein levels and self-dimerization (A) HeLa cells were transfected with green fluorescent protein (GFP)-tagged mutant.

The NF-κB-binding site of the uPAR promoter is required forβ 3-endonexin-mediated downregulation of the uPAR gene transcription. The NF-κB-binding site.

Molecular Therapy - Nucleic Acids

Targeting DCLK1 by miRNA-137.

Inactivation of human TRAC and CD52 genes by TALENs

Volume 25, Issue 4, Pages e3 (October 2018)

BRCA1 protein functional domains and predicted frameshift and premature truncation. BRCA1 protein functional domains and predicted frameshift and premature.

Presentation transcript:

Monnat Lab progress monomerizations of Cre, Mso (Hui) 2 nd round designs vs. Anopheles targets (Umut) in vivo recombination reporter assays (Ray, Hui) completed/sequence-verified reporters completed expression vectors functional analyses of Sce/Ani/Cre to discuss: expression vectors/target cells

Monomerization of Homing Endonucleases Gene synthesis Scalley-Kim M. et. al. Protein Science (2003), 12: Doyon JB et. al. J.A.C.S. (2006), 128: Library size: ~1×10 6

The Length and Aa Distribution of Linkers 19 various linkers were identified from Cre library with length from 13 Aa to 73 Aa. 13 various linkers were identified from Mso library with length at 13 and 33 Aa.

In Progress Structural analysis by crystallography. Biochemical study: Binding by isothermal titration calorimetry (ITC) and fluorescence anisotropy. Thermal stability by circular dichroism ( CD). Cleavage specificity matrix In vivo function assay using pDR-GFP recombination system. Verification of monomeric HEs as novel platform for future engineering. Introduction of mutations with known specificity changes in single domain. Construction of Cre and Mso heterodimer.

TgcgcGTcgCTCAGGgcAaTGAA GELSOLIN CgAtcGcaaCGCAAGTGCaGGAT CHEERIO TTctcCcagCGCAAcTACGTGAA YOLKLESS CAAgAGccatTTAAaAATCTGAA HIV1 WT: CCAAACTGTCTCAAGTTCCGGCG Engineering Targets 9.14 kb 43.6 kb 7.14 kb

TgcgcGTcgCTCAGGgcAaTGAA GELSOLIN 1. CgcgcCTGTCTCAAGTTCCGGCG 2. CCAAACTcgCTCAAGTTCCGGCG 3. CCAAACTGTCTCAAGgcaaGGCG CgAtcGcaaCGCAAGTGCaGGAT CHEERIO 4. CCAtcCTGTCTCAAGTTCCGGCG 5. CCAAACcaaCTCAAGTTCCGGCG TTctcCcagCGCAAcTACGTGAA YOLKLESS 6. CCctcCTGTCTCAAGTTCCGGCG 7. CCAAACcagCTCAAGTTCCGGCG CAAgAGccatTTAAaAATCTGAA HIV1 8. CCAAACccatTCAAGTTCCGGCG WT: CCAAACTGTCTCAAGTTCCGGCG Engineering Targets

Cleavage Assays substrate products controls + – + – substrate products Design 1Design 2Design 4 Design 5Design 7Design 8 3 kb

Universal pDRGFP/HEG-specific reporter plasmids sequence verified: pDRGFP-Sce pDRGFP-Ppo pDRGFP-Ani pDRGFP-AniLib4 pDRGFP-Dre3 pDRGFP-Dre4 pDRGFP-Mso pDRGFP-Ceu pDRGFP-Cpa pDRGFP-Dpa pDRGFP-Cre (Hui) Xba SpeI HE cut site XhoI/KpnI/SacI AflII carb puro GFP 5' iGFP 3'

HEG expression vectors HEGpCS2pCMVother I-SceI: pCSce, pCMVSce- I-AniI: pCSAni -pHyperAniK (pCMV+pEF) I-PpoI: -pCNPpo6- I-CreI: pCSCrepCMVCre3- I-SpomI: pCSSpom pCMVSpom-

293T – 72h after transfection -/pEGFP-C1 (FuGENE6) GFP PI (dead) -/pEGFP-C1/CaPO4 15.5% 56.9% -/pDRGFPuniv 0.5%

pCMVSce/pDRGFPSce pCSAni/pDRGFPAni pCSAni/pDRGFPLib4 293T – 72h after transfection (FuGene6) 1.5% 0.2% 0.4%

%GFP (hrs) cells/plasmid(s)tf487296hrs 293TCaPO EGFP-C DRGFPuni Sce/DRSce Ani/DRAni EGFP-C1FuGENE DRGFPuni Sce/DRSce Ani/DRAni Ani/DRLib4Ani0.40.7

In vivo Cre Cleavage-Mediated Recombination -/-pEGFP pDRGFP-Cre pDRGFP-Cre/pCSCreWTpDRGFP-Cre/pCSCreD20N

Splice site prediction in HE ORFs Prediction of cryptic splice sites in HE ORFs using Alternative splice site predictor ( Berkeley Drosophila genome project splice site prediction ( NetGene2 ( GenScan ( TIGR Gene splicer (

Splice site prediction for I-AniI (JO1387) AFN conf. AFAF AFN const. crypt. sd sa 31 AF 337 AF 424 AFN AF A(SSP)F(ruitfly)N(etGene2) const. crypt.