©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding.

©2001 Timothy G. Standish Replication Timothy G. Standish, Ph. D.

©2001 Timothy G. Standish The Information Catch 22 With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination." Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p20

©2001 Timothy G. Standish Tools of Replication Enzymes are the tools of replication: DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other Primase - Provides an RNA primer to start polymerization Ligase - Joins adjacent DNA strands together (fixes “nicks”)

©2001 Timothy G. Standish More Tools of Replication Helicase - Unwinds the DNA and melts it Single Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase Gyrase - A topisomerase that Relieves torsional strain in the DNA molecule Telomerase - Finishes off the ends of DNA strands

©2001 Timothy G. Standish Leading Strand Laging Strand 3’ 5’ 3’ 5’ Extension - The Replication Fork 5’ 3’ 5’ 3’ 5’ Single strand binding proteins - Prevent DNA from re- anealing DNA Polymerase Okazaki fragment RNA Primers Primase - Makes RNA primers 5’ 3’ 5’ Gyrase - Relieves torsional strain Helicase - Melts DNA

©2001 Timothy G. Standish Extension - Okazaki Fragments The nick is removed when DNA ligase joins (ligates) the DNA fragments. 3’5’ 3’ RNA PrimerOkazaki Fragment RNA and DNA Fragments Nick DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. DNA Polymerase falls off leaving a nick. DNA Pol. 3’5’ 3’ RNA Primer DNA Pol. 3’5’ 3’ RNA Primer Ligase

©2001 Timothy G. Standish The Role of DNA Gyrase Helicase

©2001 Timothy G. Standish The Role of DNA Gyrase Helicase Supercoiled DNA Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish The Role of DNA Gyrase Gyrase

©2001 Timothy G. Standish E. coli DNA Polymerases E. coli has three identified DNA polymerases each of which has significantly different physical characteristics and roles in the cell Replication polymerization 10 subunits 600,000 Daltons IIIIIIPolymerase Major function 400?15Molecules/cell Yes 5’- 3’ Polymerization Yes 3’-5’ Exonuclease Klenow fragment (76,000 Daltons), prepared by mild proteolysis, lacks 5’ to 3’ exonuclease activity and is used in sequencing Repair of damaged DNA YesNo 5’-3’ Exonulcease Proofreading/ Removal of RNA primers 109,000 Daltons

©2001 Timothy G. Standish TelomereTelomerase At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from 3’5’ 3’ + 5’ 3’ Degradation of RNA primer at the 5’ end 3’ 5’ 3’ 5’ 3’ Next replication

©2001 Timothy G. Standish AACCCCAAC Telomerase RNATelomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG

©2001 Timothy G. Standish AACCCCAAC Telomerase RNATelomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG

©2001 Timothy G. Standish AACCCCAAC Telomerase RNATelomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG

©2001 Timothy G. StandishTelomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG 3’CTGGCTCGG O N H N H H N N N Guanine O N H N H H N N N

©2001 Timothy G. StandishTelomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG 3’GTTGGGG 3’CTGGCTCGG T T GGGGTTG DNA Pol.

©2001 Timothy G. StandishTelomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG AGAACCCAACCCGTTGGGG 3’CTGGCTCGG T T DNA Pol. Endo- nuclease

©2001 Timothy G. StandishTelomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG 3’CTGGCTCGG Endo- nuclease AGAACCCAACCC GTTGGGG T T

©2001 Timothy G. Standish

Mutation When Mistakes Are Made 5’3’ 5’ DNA Pol. 5’ 3’ 5’3’ 5’ DNA Pol. DNA Pol. Mismatch 3’ to 5’ Exonuclease activity

©2001 Timothy G. Standish Thimine Dimer Mutation Excision Repair 3’ 5’3’ 5’ 3’ 5’ Endo- Nuclease

©2001 Timothy G. Standish 5’3’ 5’ 3’ 5’ Mutation Excision Repair 3’ 5’3’ 5’ Endo- Nuclease Nicks DNA Pol.

©2001 Timothy G. Standish 5’3’ 5’ Mutation Excision Repair 3’ 5’3’ 5’ 3’ 5’ DNA Pol. Endo- Nuclease

©2001 Timothy G. Standish 5’3’ 5’ 3’ 5’ Mutation Excision Repair 3’ 5’3’ 5’ DNA Pol. Ligase Endo- Nuclease Nicks Nick Ligase

©2001 Timothy G. Standish O N H N H H N N N

DNA Replication: How We Know There are three ways in which DNA could be replicated: + New Old + New Old New Old Conservative - O ld double stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together Old Semi-conservative - Old strands serve as templates for new strands resulting in double stranded DNA made of both old and new strands Old Dispersive - In which sections of the old strands are dispersed in the new strands + Old + New Old + New + Old + New Old + New or

©2001 Timothy G. Standish The Meselson-Stahl Experiment The Meselson-Stahl experiment demonstrated that replication is semiconservative This experiment took advantage of the fact that nucleotide bases contain nitrogen Thus DNA contains nitrogen OH H P O HO O NH2NH2 N N N N The most common form of Nitrogen is N 14 with 7 protons and 7 neutrons N 15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit

©2001 Timothy G. Standish After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Dispersive model prediction Conservative model prediction Semi-conservative model prediction The Meselson-Stahl Experiment Prediction after 2 or more replications Bacteria grown in N 15 media for several replications Transfer to normal N 14 media X X X The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semi-conservative model must be true.

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model Meiosis Prophase I Homologous chromosomes

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model Double strand break Exo- nuclease

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model Exo- nuclease

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model Exo- nuclease

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model Exo- nuclease

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model DNA Polymerase

©2001 Timothy G. Standish The Current Eukaryotic Recombination Model

©2001 Timothy G. Standish Holliday Structure

©2001 Timothy G. Standish Holliday Structure Bend

©2001 Timothy G. Standish Holliday Structure Bend Twist

©2001 Timothy G. Standish Holliday Structure Cut

©2001 Timothy G. Standish Holliday Structure Cut

©2001 Timothy G. Standish Holliday Structure Cut

©2001 Timothy G. Standish Holliday Structure Cut

©2001 Timothy G. Standish Holliday Structure

©2001 Timothy G. Standish Cutting The Holliday Structure