MUTAGENS AND MUTAGENESIS. Mutagens  Naturally occurring mutations are referred as spontaneous mutations and are thought to arise through chance errors.

Slides:

Advertisements

Similar presentations

Advertisements

Chapter 13.3 (Pgs ): Mutations

DNA Replication, Repair, & Recombination Chapter 12 By: Alison Avery.

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.

DNA damage, repair and recombination

GENETICS Genetics is the study of the transmission of things from one generation to the next Genetic characteristics of a population can change over time.

The Mutability and Repair of DNA

7 Mechanisms of Mutation and DNA Repair. Mutations Spontaneous mutation : occurs in absence of mutagenic agent Rate of mutation: probability of change.

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Lesson Overview 13.3 Mutations.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Dr Mohammad S Alanazi, MSc, PhD Molecular Biology KSU DNA repair: mechanisms, methods to study DNA repair, syndromes.

Lesson Overview Lesson OverviewMutations Lesson Overview 13.3 Mutations.

William S. Klug Michael R. Cummings Charlotte A. Spencer Concepts of Genetics Eighth Edition Chapter 15 Gene Mutation, DNA Repair, and Transposition Copyright.

5. Point mutations can affect protein structure and function

Chapter 18 – Gene Mutations and DNA Repair

Lesson Overview 13.3 Mutations.

Gene and Chromosomal Mutations. What is a mutation? Mutations are changes made to an organism’s genetic material. These changes may be due to errors in.

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

Introduction to Molecular Genetics Studiju materiāli / MolekularasBiologijas / Ievads MolGen / EN.

Mutations 13.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Mutations. Mutations are changes in the genetic message  If the DNA in all of the cells of an adult human were lined up end-to-end, it would stretch.

GENETICS ESSENTIALS Concepts and Connections SECOND EDITION GENETICS ESSENTIALS Concepts and Connections SECOND EDITION Benjamin A. Pierce © 2013 W. H.

DNA Repair DNA repair is a system used to correct DNA damage caused by either: 1-Errors during DNA replication including incorrect base-pairing (mismatching)

Chapter 8: Bacterial Genetics. Genetic changes in bacteria occur via: -mutations -gene transfer.

1.Structures and Functions of Nucleic Acids 2.Organization and Content of Genomes 3.DNA Replication 4.The Mutability and Repair of DNA 5.DNA Recombination.

DNA Repair DNA repair is a system used to correct DNA damage caused by either: A- Errors during DNA replication including incorrect base-pairing (mismatching.

Today’s Agenda: 1. A Microarray Primer 2. Guest Speaker: Dr. Michael Schlador 3. Follow-up: the Use of Microarray Analysis in Chemotherapeutics 4. Preview.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Chapter 2 Genetic Variations. Introduction The human genome contains variations in base sequence from one individual to another. Some sequence variants.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Regulation of Bacterial Gene Expression Constitutive enzymes are expressed at a fixed rate. Other enzymes are expressed only as needed. –Repressible enzymes.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Genetics. Mutations of Genes Mutation – change in the nucleotide base sequence of a genome; rare Not all mutations change the phenotype Two classes of.

11.1DNA Is Reproduced by Semiconservative Replication.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

Copyright © 2011 Pearson Education Inc. Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville M I C R O B I O L O G Y WITH DISEASES.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

13.3 Mutations KeyQuestions: 1)What are mutations? 2)How do mutations affect genes? The sequence of bases in DNA are like the letters of a coded message.

Lesson Overview 13.3 Mutations. THINK ABOUT IT The sequence of bases in DNA are like the letters of a coded message. What would happen if a few of those.

12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

Lesson Overview 13.3 Mutations.

Variation Mutations DNA repair

Section 11.3: Genetic Changes

12.4 Assessment Answers.

Lesson Overview 13.3 Mutations.

Lesson Overview 13.3 Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Lesson Overview 13.3 Mutations.

11.3 Section Objectives – page 296

Chapter 8, part C Microbial Genetics.

Recombinant DNA & Mutations

Mechanisms for the Diversity of Life

Mutations + Recombination = Genetic Variation!!

Lesson Overview 13.3 Mutations Objectives:

Lesson Overview 13.3 Mutations.

Lesson Overview 13.3 Mutations.

Lesson Overview 13.3 Mutations.

DNA Mutations Types & their effects.

Mutation and DNA repair

Presentation transcript:

MUTAGENS AND MUTAGENESIS

Mutagens  Naturally occurring mutations are referred as spontaneous mutations and are thought to arise through chance errors in chromosomal division or DNA replication.  Environmental agents which cause mutations are known as mutagens  These include natural or artificial ionizing radiation and chemical or physical mutagens

Causes of Spontaneous mutations Causes of Spontaneous mutations  error in DNA replication  faulty DNA repair e.g. mismatch  natural mutagens

Mutagens  Mutagens could be  Physical  Chemical  Biological

Physical Mutagens  Radiation  Non-ionizing  Ultraviolet (UV)  Ionizing  X-Rays

Chemical Mutagens  Mutagenic chemicals in food contribute to 35% of cancers  Studies showed that certain chemicals such as Formaldehyde, benzene, some type of dyes cause chromosomal breaks and aneuploidy.

Biological Mutagens  Insertion of a transposon (mobile genetics elements has the ability to move and inserted into a gene) within a gene  disrupts the reading frame  loss of function  Antibiotic resistance

Mutagenesis A process by which the genetic information of an organism is changed in a stable manner, either in nature or experimentally by the use of chemicals or radiation

DNA-repair mechanisms  DNA-repair mechanisms exist to correct DNA damage due to:  1- Environmental mutagens.  2-Accidental base misincorporation at the time of DNA replication.

DNA-repair mechanisms  There are four different types of DNA-repair mechanisms:  Excision repair  Mismatch repair  Recombination repair system  Double-strand repair

Excision repair system  Excision repair system : removing one strand with damage DNA site.  Excision repair can be  Base-excision repair  Nucleotide-excision repair  The system recognise the damaged site which caused by UV and radiation.  Three protein are important in this process (XPA, XPB, and XPC).  Theses protein detect the damaged site and form which is known as repair protein complex.

Mismatch repair system  Mismatch repair system corrects the errors of replication  Eight gene loci have been identified

Replication repair system  DNA damage interfere with replication and transcription.  In replication: DNA damaged will affect the leading strand  In transcription: DNA damage will affect the process due to RNA polymerase cannot use the leading strand as a template.

Double-strand repair system  Double-strand damage is a common consequence of gamma radiation.  The process require three important genes  ATM (ataxia telangiectasia)  BRCA1  BRCA2

Thanx