MM Intercalation of Organic Molecules into Layered Double Hydroxide (LDH): Comparison of Simulation with Experiment H. Zhang a,b, Z. P. Xu b, G. Q. Lu b and S. C. Smith a,b a) Centre for Computational Molecular Science, Australian Institute for Bioengineering and Nanotechnology The University of Queensland, Qld 4072, Brisbane, Australia. b) ARC Centre for Functional Nanomaterials, Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Qld 4072, Brisbane, Australia.

MM Outline Introduction –Hybrid system: layered double hydroxides (LDHs) + sulfonate; LDH + siRNA; LDH + Heparin. Method –MD simulations with COMPASS for hybrid organic- inorganic system. –DFT for smaller model systems. Selected results LDH + sulfonate: Zhang, Xu, Lu, and Smith, J Phys Chem C, 2008, 113, 559. Current focus: siRNA / heparin + LDH

MM Layered double hydroxides (LDH) - -Importance: heterogeneous catalysis, heat stabilizers, molecular sieves or ion exchangers, biosensors and halogen scavengers, drug delivery, and gene therapy. Mg 6 Al 2 (OH) 16 CO 3  4H 2 O Space group: r3-m Rhombohedral lattice parameters a = Å, c = Å,  = 90 ,  = 90  and γ = 120  anion exchangeable: anion exchangeable: C 8 H 17 SO 3 - ; siRNA; heparin

MM Part I LDH + siRNA System Inorganic Nanoparticles as Carriers of Nucleic Acids (DNA/RNA) into Cells 1. The transfer of DNA / RNA into living cells, that is, transfection, is a major technique in current biochemistry and molecular biology. This process permits the selective introduction of genetic material for protein synthesis as well as the selective inhibition of protein synthesis (antisense or gene silencing). 2.In particular, the introduction of small interfering RNA (siRNA) into mammalian cells has become an essential tool for analyses of gene structure, function and regulation; It is also the conceptual basis for a medical technique called “gene therapy” that potentially allows the treatment of a wide variety of diseases of both genetic and acquired origin.

MM LDH + siRNA (Cont.)

MM No matter how good and 'smart' these therapeutic siRNAs are, efficient carriers are needed as nucleic acids alone are not able to penetrate the cell wall. Furthermore, they need to be protected from enzyme destruction while they are on their way to the target cells. 2.Besides viral, polymeric, and liposomal agents, inorganic nanoparticles like LDH are especially suitable for this purpose because they can be prepared and surface-functionalized in many different ways. As a result of their small size, nanoparticles can penetrate the cell wall as well as the blood –brain barrier and deliver siRNA into living systems. The transfer mechanism of nanoparticles into a cell and into its nucleus. I Adsorption on the cell membrane. II Uptake by endocytosis. III– IV Escape from endosomes and intracellular release. V Nuclear targeting. VI Nuclear entry and gene expression. (Angew. Chem. Int. Ed. 2008, 47, 1382)

MM 20097

8 1.For smaller models, a general ab initio force field (Condensed-phase Optimized Molecular Potentials for Atomistic Simulation Studies: COMPASS) and quantum mechanical density functional theory are used to perform geometry optimization, to compute IR spectrum and to calculate atomic charges. 2.For the hybrid LDH systems, the general ab initio force field (COMPASS) is used for all the molecular dynamics simulations (Discover in Material Studio MS 4.4). 3.For powder x-ray diffraction pattern calculations, we have employed the REFLEX module in MS 4.4. Simulation Method

MM Current Focus I (siRNA-LDH) Fig. 1 Minimized structures using Discover and COMPASS forcefield. (a) A-RNA and (b) A’-RNA. Sequence of the 21 base pair siRNA are: Sense 5'- GCAACAGUUACUGCGACGUUU-3' Antisense 3'- UUCGUUGUCAAUGACGCUGCA -5’ (a) (b)

MM Current Focus I (LDH-siRNA) (b) LDH+A’-RNA (a) LDH+A-RNA Fig. 2 Structures for LDH/siRNA hybrid systems. (a)(b)

MM (b) LDH+A’-RNA (a) LDH+A-RNA Fig. 3 Minimized structures from fix LDH layer simulations. (a) (b)

MM (b) LDH+A’-RNA (a) LDH+A-RNA Fig. 4 Minimized structures for fully relaxed LDH-siRNA systems. (a)(b)

MM Current Focus I (LDH + siRNA) Movie 1: fixed LDH layer simulations for LDH+A-RNA system from 500 ps MD simulations.

MM Fig. 5 Calculated PXRD for the hybrid system from minimized structures. (a) fixed LDH + A-RNA; (b) relaxed LDH + A-RNA; (c) fixed LDH + A’-RNA; (d) relaxed LDH + A’-RNA. (a) (b) (c) (d)

MM Fig. 6 Atomic density profiles from 500 ps of fully relaxed MD simulations for the LDH + A-RNA system at 300 K. The red line represents Al atoms in the LDH layer, the blue line represents oxygen atoms of water, and the cyan line represents Cl anions, and the green line represents P atoms in siRNA. Al --- red; O --- blue; Cl --- cyan; P --- green.

MM Part II: LDH-Heparin System 1.Motivation pharmaceutical applications for drug delivery using LDH as carriers their low toxicity compared to other nanoparticles; high anion-exchange properties; protective delivery carriers for drugs; stability through tight binding with LDH layers; enhanced drug effects; enhanced cellular uptake (optimum size 100 to 200 nm); improved solubility and biocompatibility of drugs; controlled drug release through partial dissolution of nano-layers in slightly acidic cellular organisms. 2. AIBN experimental work: 1) 1) Gu, Thomas, Xu, Campbell and Lu, Chem. Mater., 2008, 20, ) Xu, Niebert, Porazik, Walker, Cooper, Middelberg, Gray, Bartlett, Lu, J. Control. Release., 2008 (doi: /j.jconrel ).

MM Fig. 1 Optimized geometry for the model of heparin uronic acids and glucosamine residues using quantum Dmol3. Population analysis was performed after the geometry optimization (see Table 1)

MM Table 1 Charge partitioning by Hirshfeld method; Mulliken atomic charges; and ESP-fitted charges (selected atoms only for illustration purpose). ElementnHirshfeldMullikenESP O S O O O C H C H O H

MM Fig. 2 Optimized structure for heparin molecule in the gas phase using Smart Minimizer in Discover and COMPASS forcefield. The convergence level is set to medium and maximum iteration number is set to 5,000.

MM Fig. 3 Optimized structures for fixed LDH layer + heparin (a) and fully relaxed LDH + heparin (b). Amorphous Cell is employed to construct the intercalate layer of heparin and water molecules. (a)(b)

MM Fig. 4 Snapshots from 2 ns MD simulations for the hybrid LDH- heparin system using Discover with COMPASS forcefield. (a) for fixed LDH layer simulation; and (b) for fully relaxed simulation. (a)(b)

MM Fig. 5 PXRD patterns for LDH-heparin system. Solid line is the simulated XRD pattern from fully relaxed LDH system, while dotted line is the simulated pattern from partially relaxed LDH system. The dashed line is the experimental result for LMWH100- LDH.

MM Current Focus II (LDH-Heparin) Movie 1: fixed LDH layer simulation for LDH + heparin system from 2 ns MD simulations.

MM Fig. 1 Optimized structures for C 8 H 17 SO 3 - using COMPASS force field (a) and quantum mechanical DFT (b). One angle between hydrocarbon chain and SO 3 - group is highlighted, which has the most noticeable change after intercalation into LDH. (Zhang, Xu, Lu, and Smith, J Phys Chem C, 2008, 113, 559) (a)(b) Part III LDH + Sulfonate System

MM Fig. 2 The minimized structure (a) and the final structure (b) after 500 ps MD simulations for fully relaxed LDH/sulfonate system. During the simulations the full hybrid system is allowed to relax. (a) (b)

MM Fig. 3 Calculated MSDs for sulfonate (a) and for water (b) from 500 ps of fully relaxed MD simulations at 300 K. From MSD the self diffusion coefficients of the interlayer sulfonate and water are estimated to be 2.05  cm 2 /s and 3.07  cm 2 /s, respectively. (a)(b)

MM Fig. 4 Comparison of PXRD pattern for the LDH-sulfonate system. The red line represents the calculated XRD pattern, whereas the blue line represents the experimental XRD pattern. In (a) the calculated XRD pattern is based on the structure from fixed LDH layer simulations, and in (b) the calculated XRD pattern is based on the structure from the fully relaxed simulations.

MM Fig. 5 Comparison of FTIR spectra for LDH-sulfonate hybrid. In (a) calculated IR spectra based on the minimized structure for fixed LDH layer simulation; In (c) the experimental FTIR spectra of Xu et al.

MM Future Work Simulations will be extended to other LDH-siRNA systems: I siRNA-Htt#1 (21 bps double stranded siRNA): sense 5’- GCGCCGCGAGUCGGCCCGAGG -3’ antisense 3’- GCCGCGGCGCUCAGCCGGGCU -5’ II siRNA-DCC#1 (21 bps): sense strand 5’-GCAAUUUGCUCAUCUCUAAtt-3’ antisense strand 3’-ttCGUUAAACGAGUAGAGAUU-5’ III siRNA-DCC#2 (21 bps): sense strand 5’-CGAUGUAUUACUUUCGAAUtt-3’ antisense strand 3’-gtGCUACAUAAUGAAAGCUUA-5’ IV siRNA-MAPK1 (21 bps): sense 5’-GGGCUAAAGUAUAUCCAUUtt -3’ antisense 3’-ctCCCGAUUUCAUAUAGGUAA -5’ These simulations are closely related to the nano-neuro initiative “Novel hybrid inorganic nano-particles for effective siRNA delivery to neurons” between QBI and AIBN. These simulations are closely related to the nano-neuro initiative “Novel hybrid inorganic nano-particles for effective siRNA delivery to neurons” between QBI and AIBN.

MM Acknowledgement Prof. Max Lu, ARCCFN, Uni of Queensland. Dr. Zhipng Xu, ARCCFN, Uni. Of Queensland. Prof. Sean C. Smith, CCMS/AIBN, Uni. of Queensland. CCMS ARCCFN