Personalized Medicine Dr. M. Jawad Hassan

Personalized Medicine Human Genome and SNPs What is personalized medicine? Pharmacogenetics Case study – warfarin etc Public policy Pros-cons

Genotypes and Human Disease Do all humans have the same DNA? What are single nucleotide polymorphisms or SNPs? Can we associate SNPs with medical histories of individuals and achieve statistically significant correlations?

“personal genetics”? Genetic testing available directly to consumers (DTC) Reading our genome sequence will soon cost under $1,000 (a routine medical test in the future?) Insights about our health, behavior and other traits Highly personal information with social, legal and familial impact Because learning about our own DNA is rapidly becoming inexpensive and accessible

Human Genome Project outcomes: A. Determined where genes are located on our chromosomes. B. Assessed # of genes humans have – between 20,000 – 25,000 (27000 now) C. The creation of a “map” or “reference sequence” to which other genomes (or parts of genomes) can be compared

Oct-11

Why personal genome analysis? Ideas for more medical tests and interventions if I learn I’m at risk To find the right drugs, in the right doses, for my conditions Motivation to my change habits Planning for my long term medical and financial needs To inform my reproductive decisions

HUJI 2006 International consortium that aims in genotyping the genome of 270 individuals from four different populations.

HUJI Launched in First phase (2005): ~1 million SNPs for 270 individuals from four populations - Second phase (2007): ~3.1 million SNPs for 270 individuals from four populations - Third phase (ongoing): > 1 million SNPs for 1115 individuals across 11 populations

AGAGCAGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCGACATGATAGCC AGAGCCGTCGACATGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCGACATGATAGTC AGAGCAGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCGACATGATAGCC AGAGCAGTCGACAGGTATAGCCTACATGAGATCAACATGAGATCGGTAGAGCAGTGAGATCGACATGATAGCC AGAGCCGTCGACATGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCAACATGATAGCC AGAGCCGTCGACATGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGCC AGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGTC AGAGCAGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC AGAGCAGTCGACATGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGCC AGAGCAGTCGACATGTATAGTCTACATGAGATCAACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC AGAGCAGTCGACATGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCAACATGATAGCC AGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGTC AGAGCCGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCAACATGATAGCC AGAGCAGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCTGTAGAGCAGTGAGATCGACATGATAGCC AGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC AGAGCCGTCGACAGGTATAGTCTACATGAGATCAACATGAGATCTGTAGAGCAGTGAGATCGACATGATAGTC Cases: Controls: Associated SNP Where should we look? SNP = Single Nucleotide Polymorphism

Published Genome-Wide Associations through 6/2009, 439 published GWA at p < 5 x 10 -8

Other Data Sources Human Genome Diversity Project – 50 populations, 1000 individuals, 650k SNPs POPRES – 6000 individuals (controls) Encode Project – Resequencing, discovery of new SNPs 1000 Genomes project dbGAP

Haplotypes Can 1,000,000 SNPs tell us everything? No, but they can still tell us a lot about the rest of the genome. – SNPs in physical proximity are correlated. – A sequence of alleles along a chromosome are called haplotypes.

A Definition of Personalized Medicine Personalized medicine is the use of information from a patient's genotype to: initiate a preventative measure against the development of a disease or condition, or select the most appropriate therapy, for an existing disease or condition, that is particularly suited to that patient.

The Leading Edge: Pharmacogenomics (PGx ) Using an individual’s genetic profile to predict response to certain drugs Clinical goal is to enable better drug treatment decisions and safer medical care Pharmaceutical industry goal is to develop more predictable and more effective drugs Genetic tests already in use to predict patient response to therapy in the fields of cancer and infectious disease

The Vision of Personalized Medicine Genetic and epigenetic variants + measurable environmental/behavioral factors would be used for a personalized treatment and diagnosis

Examples of SNPs Linked to Drug Response

Case Study: Warfarin Most widely prescribed oral anticoagulant for preventing thrombolytic events, despite its narrow therapeutic range Problematic dosing due to patient’s diet, age, and other medications Second most common drug implicated in adverse drug reaction-linked emergency room visits

Personalized Warfarin Dosing One-third of thrombosis patients metabolize their warfarin dose differently than expected due in large part to variations of 2 genes,VKORC1 and CYP2C9 VKORC1 SNPs, such as the 1639G>A allele, indicate that a patient will respond well to a lower dose of warfarin CYP2C9*2 and CYP2C9*3 alleles encode SNP variants of CYP2C9 with reduced efficiency in degrading warfarin Warfarin labeling suggesting genetic testing of VKORC1 and CYP2C9 is the first indication of personalized dosing being approved by the FDA

Example 1: Pharmacogenetics Claim obtaining a nucleic acid sample from said human subject; subjecting the sample to PCR and identifying i and/or ii: i) in the subject’s VKORC1 gene, the nucleotide base at position X of SEQ ID NO:1 in the sample from the subject and/or ii) in the subject’s CYP2C9 gene, the nucleotide base at position Y of SEQ ID NO:2 in the sample from the subject; and Treating the human subject with a dosage of warfarin indicated by their genotype as identified in b.

Example 2: SNP Claim An isolated nucleic acid sequence comprising SEQ ID NO:1. The specification teaches that SEQ ID NO:1 is a variant of the ERBB2 gene having an A (adenine) to C (cytosine) mutation at position 101 (A101>C). This mutation (A101>C) is typically found in breast cancer patients. this mutation (A101>C) correlates with a significantly better response to “breast cancer drug X” versus placebo. without mutation (A101>C), “breast cancer drug X” is an ineffective treatment.

The Debate on Direct-to-Consumer Tests Pros Early warning about predisposition could promote healthier lifestyles Cons Is the data more harmful than helpful without context? (patient confidentiality) Is it beneficial to be informed that you are at high risk to develop a disease for which there is no cure?

Personal genomes: what are the challenges? 1. How far ahead is the technology of its clinical usefulness? 2. How much information would you want to know? 3. Will fair weight be given to environmental & social factors? 4. How will your genetic information affect your family? 5. How much should we be concerned about discrimination at work and by insurance companies? 6. How can we ensure access for all?

For more information, please visit