(A) RdRP 5‘UTR3‘UTR CP MP SP6 (B) (C) 3 dpi 15 dpi (D) Supplementary Figure 1 Infectivity analysis of Nicotiana tabacum. Schematic illustration of the.

Slides:



Advertisements
Similar presentations
1- Bendahmane, A., Querci, M., Kanyuka, K. and Baulcombe, D Agrobacterium transient expression system as a tool for the isolation of disease resistance.
Advertisements

Section G Gene manipulation
Identification of AFLP markers linked to tomato spotted wilt virus resistance in tobacco NC STATE UNIVERSITY H. Moon and J.S. Nicholson Department of Crop.
20,000 GENES IN HUMAN GENOME; WHAT WOULD HAPPEN IF ALL THESE GENES WERE EXPRESSED IN EVERY CELL IN YOUR BODY? WHAT WOULD HAPPEN IF THEY WERE EXPRESSED.
Jenny Patoka, Rizwana Ali, and Matthew D. Koci Department of Poultry Science, North Carolina State University, Raleigh, NC Introduction Astroviruses are.
90- How can we make more insulin? V How can we make more insulin? By Transforming Bacteria V
Supplement Figure 1A. Representative 2D gel image of normal whey with 32 differently expressed protein spots identified by peptide mass fingerprinting.
Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.
Section G Gene manipulation
Virus Overview General characteristics of viruses
Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic.
Bacterium-induced basal resistance inhibits viral infection in tobacco plants László ZSIROS 1,2, Ágnes SZATMÁRI 1, László PALKOVICS 2, Zoltán KLEMENT 1.
Lecture 11 &12 Virus resistant plants. Expression of dsRNase(RNaseIII) wheat engineered to express the E. coli gene for ribonuclease (RNase) III wheat.
Genetically Modified (GM) Foods GM foods can be either transgenic or cisgenic. The transgene codes for a protein that is somehow advantageous to the plant.
Fig. 1.
Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin.
A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.
PreimmuneMonoclonalanti-Aur-AAffinity Purified anti-Aur-A Blot: retic lysate translation product oocyte extract retic lysate translation.
Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD.
Abstract Results Polyamines are implicated in a wide array of fundamental processes in plants such as adaptation and tolerance to environmental stresses.
Sesha Kiran Kollipara, Vikas Solanki and Bikash Mandal
Table A. Sequences used in making CsKASII RNAi constructs
(A) (B) Supplementary Fig. 1 Sequence alignment and Phylogenetic analysis of DJ-1 homologs. (A). Multiple sequence alignment of DJ1 homologs from A.
Supplemental Figure 1 A) B) C)
Relationship between Genotype and Phenotype
RNA-directed transcriptional gene silencing in plants can be inherited independently of the RNA trigger and requires Met1 for maintenance  Louise Jones,
The Ordered Transcription of RNA Domains Is Not Essential for Ribosome Biogenesis in Escherichia coli  Kei Kitahara, Tsutomu Suzuki  Molecular Cell  Volume.
Volume 7, Issue 4, Pages (April 2014)
Damien Garcia, Shahinez Garcia, Olivier Voinnet  Cell Host & Microbe 
Volume 101, Issue 5, Pages (May 2000)
pSYNV-MR reporter gene expression in agroinfiltrated N
Volume 3, Issue 1, Pages (January 1999)
Guido Van den Ackerveken, Eric Marois, Ulla Bonas  Cell 
Volume 7, Issue 4, Pages (April 2014)
Volume 101, Issue 5, Pages (May 2000)
Volume 36, Issue 2, Pages (October 2009)
John T. Arigo, Kristina L. Carroll, Jessica M. Ames, Jeffry L. Corden 
(a) (b) FhGALE M U I S W1 W2 E1 E2 E3 M - +
Volume 14, Issue 9, Pages (May 2004)
Zebrafish: A Model System to Study Heritable Skin Diseases
High Frequency Retrotransposition in Cultured Mammalian Cells
Initiation of RPS2-Specified Disease Resistance in Arabidopsis Is Coupled to the AvrRpt2-Directed Elimination of RIN4  Michael J. Axtell, Brian J. Staskawicz 
RNA-Guided Genome Editing in Plants Using a CRISPR–Cas System
Systemic Spread of Sequence-Specific Transgene RNA Degradation in Plants Is Initiated by Localized Introduction of Ectopic Promoterless DNA  Olivier Voinnet,
Volume 10, Issue 10, Pages (October 2017)
Knockdown of Rpn11 inhibits TBSV accumulation in plants.
DNA Topoisomerase I and PC4 Can Interact with Human TFIIIC to Promote Both Accurate Termination and Transcription Reinitiation by RNA Polymerase III 
Volume 8, Issue 8, Pages (August 2015)
Volume 10, Issue 10, Pages (October 2017)
Volume 96, Issue 3, Pages (February 1999)
Volume 10, Issue 1, Pages (January 2017)
Volume 1, Issue 2, Pages (January 1998)
Volume 10, Issue 3, Pages (September 2002)
Transcription Protein Synthesis.
Volume 15, Issue 10, Pages (May 2005)
tssRNA promoter analysis and function.
Olivier Voinnet, Carsten Lederer, David C Baulcombe  Cell 
RNA Helicase A Mediates Association of CBP with RNA Polymerase II
Template Switching by RNA Polymerase II In Vivo
Figure S1. Schematic representation of the RieskeFeS over-expression vector pGWRi used to transform Arabidopsis (Col-0). cDNA are under transcriptional.
Volume 8, Issue 20, Pages (October 1998)
Volume 2, Issue 3, Pages (May 2009)
Volume 30, Issue 1, Pages (April 2008)
Transcriptional Regulation by p53 through Intrinsic DNA/Chromatin Binding and Site- Directed Cofactor Recruitment  Joaquin M Espinosa, Beverly M Emerson 
Volume 5, Issue 5, Pages (September 2012)
Volume 8, Issue 3, Pages (March 2015)
Volume 121, Issue 4, Pages (May 2005)
Volume 3, Issue 1, Pages (January 1999)
Volume 2, Issue 4, Pages (July 2009)
Volume 1, Issue 5, Pages (September 2008)
Presentation transcript:

(A) RdRP 5‘UTR3‘UTR CP MP SP6 (B) (C) 3 dpi 15 dpi (D) Supplementary Figure 1 Infectivity analysis of Nicotiana tabacum. Schematic illustration of the TMV RNA expression vector pT2SB (a) and the infection construct of this vector (b). Leaves of Nicotiana tabacum cv. Xanthi NN (c) and Xanthi nn (d) were dusted with carborundum and rub inoculated with RNA either generated by in vitro transcription with pT2SB as template (left) or purified from wtTMV (right). After infection, plants are grown under standard conditions. dpi, days post infection.

pT2SB:SP1-1 Nicotiana tabacum cv. Xanthi NN Nicotiana tabacum cv. Xanthi nn Supplementary Figure 2 Infectivity analysis of Nicotiana tabacum. (a) Schematic illustration of the infection construct of pT2SB:SP1-1. (b) Nicotiana tabacum cv. Xanthi NN and Xanthi nn were infected with RNA derived from in vitro transcription of pT2SB:SP1-1. Both the resistant and the susceptible cultivar show distinct HR-lesions 6 dpi that restricted the recombinant TMV from local cell-to-cell movement in the leaf and inhibited formation of infection. RdRP 5‘UTR3‘UTR CP - M - AMP MP SP6 (A) (B)

Supplementary Figure 3 pAGRO::T2SB-CP_cc_SP1-1cc as example for an agroinfiltration vector. RdRP, RNA-dependent RNA polymerase; p35S, CaMV 35S promoter; Ap R, ampicillin resistance gene; UTR, untranslated region; CNBr, cyanogen bromide; RB, right border; LB, left border; Nos term, nopaline synthase terminator. pAGRO:T2SB-CP_cc_SP bp

M kDa Supplementary Figure 4 Acetic acid extraction of T2SB_CP_cc_SP1-1. The acid extract was dialysed against water oN and proteins pI precipitated by adjusting the pH to 5.5 with NaOH. Precipitated proteins were centrifugated and resuspended in 1/5 volume of buffer corresponding to the volume of the acetic acid extract and separated on 15%-SDS-PAGE. 1, T2SB_CP_cc_SP1-1; 2, wtTMV CP as size control. Relative molecular marker standards are shown on the right. M, marker; kDa, kilodalton.