The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Diagram of the Current System 3. Stimulant – Schistosoma 4.Display.

Slides:



Advertisements
Similar presentations
Cell Communication Cells need to communicate with one another, whether they are located close to each other or far apart. Extracellular signaling molecules.
Advertisements

Apoptosis By Douglas R. Green
1. Complement System 2. Antigen Specific Receptors K.J. Goodrum Department of Biomedical Sciences 2005.
Complement Terry Kotrla, MS, MT(ASCP)BB Fall 2007.
1 Antibody Concentration – Primary and Secondary Response Primary Response 1.Infection (Ag) 2.Lag phase 3Antibodies produced 4Antibody level rises to combat.
ENZYMES: KINETICS, INHIBITION, REGULATION
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
PROTEIN TRAFFICKING AND LOCALIZATION PROTEINS SYNTHESIZED IN CYTOPLASM, BUT BECOME LOCALIZED IN CYTOPLASM CYTOPLASMIC MEMBRANE PERIPLASM OUTER MEMBRANE.
Translation Translation is the process of building a protein from the mRNA transcript. The protein is built as transfer RNA (tRNA) bring amino acids (AA),
Lecture 14: Regulation of Proteins 1: Allosteric Control of ATCase
Transcription strategies of viruses
Introduction to Metabolism __________ in nature – many reaction pathways the same or similar in many organisms Two general categories of organisms –_________.
Figure 13.9 Initiation and elongation steps of transcription.
Nucleic Acids 7.3 Translation.
Molecular Physiology: Enzymes and Cell Signaling.
Immunoglobulins as Binding Proteins Lecture 10, Medical Biochemistry.
Cell Signaling & Communication. Cellular Signaling cells respond to various types of signals signals provide information about a cell’s environment.
Synthetic biology: New engineering rules for emerging discipline Andrianantoandro E; Basu S; Karig D K; Weiss R. Molecular Systems Biology 2006.
● Testosterone causes muscle growth ● When overused ( x normal therapeutic levels) it causes male-pattern muscle development in women...
How do proteins fold? Folding in a test-tube The structure of proteins is determined by the amino acid sequence; many proteins in solution can be unfolded.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Microbial Biotechnology Philadelphia University
Protein Synthesis Biology 11 preAP Overview and Application.
There are four main types of membrane proteins:- Transporters – these help the passage of ions, sugars, amino acids, nucleotides and many other metabolites.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Proteins Mohamed Bingabr, Ph.D. Associate Professor Department of Engineering and Physics University of Central Oklahoma.
Cell Communication.
Chapter 8 Lecture Outline
Translation. What I need to know:- 1.What translation is 2.The role of tRNA 3.Know about anticodons and codons 4.The function of start/stop codons 5.One.
Cell Communication Chapter Cell Communication: An Overview  Cells communicate with one another through Direct channels of communication Specific.
Cell to Cell Communication
Cell Communication.
Cell Communication (Chpt. 11) Chapter 11. Overview of Cell Signaling Signaling evolved early in history of life Communicating cells may be close together.
Unit 1 Cell and Molecular Biology Section 6 Catalysis.
Isozymes Covalent Modification Protein Kinase A
Chapter 11: Cell Communication. Cell to cell recognition: Yeast cells: secrete chemical signals which bind to specific receptors Start to grow towards.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Basic Immunology University of Tabuk Faculty of Applied Medical Science Department of Medical Laboratory Technology Mr.AYMAN.S.YOUSIF MSc.Medical Microbiology.
Chapter 14: Signaling Pathways That Control Gene Activity
Baccelerator Overview Assembly strategy Testing strategy Issues Modelling.
(C) 2002, SNU Biointelligence Lab, Strategies for the development of a peptide computer Hubert Hug and Rainer Schuler Bioinformatics,
Investigation of the enzymatic processes depending on the type of reaction.
Genes in development Signal transduction pathways and
Higher Human Biology Unit 1 Human Cells KEY AREA 3: Gene Expression.
What is phage display? An in vitro selection technique using a peptide or protein genetically fused to the coat protein of a bacteriophage.
Lesson 4- Gene Expression PART 2 - TRANSLATION. Warm-Up Name 10 differences between DNA replication and transcription.
7.3 Translation Understanding: -Initiation of translation involves assembly of the components that carry out the process -Synthesis of the polypeptide.
Cell Signaling In order to respond to changes in their immediate environment, cells must be able to receive and process signals that originate outside.
CHM 708: MEDICINAL CHEMISTRY
Protein and toxin export and secretion
Production of Recombinant Proteins
CHAPTER 11 CELL COMMUNICATION
Cell Communication.
Cell Communication.
Basics of Signal Transduction
Cell Signaling (Lecture 1)
Cell Communication.
Cell Communication.
Chapter 11 Cell-to-cell communication is essential for multicellular organisms Biologists have discovered some universal mechanisms of cellular regulation.
Cell Communication (1.4) – Part 1
Increasing Protein Stability
Weapons delivery & deployment
Termination of Translation
The Baccelerator: Back on track…
Terry Kotrla, MS, MT(ASCP)BB
Chapter 11 Cell Communication.
7.3 Translation Understanding:
Cell Biology Van Leeuwenhoek and his microscope
Stephen T. Chisholm, Gitta Coaker, Brad Day, Brian J. Staskawicz  Cell 
Presentation transcript:

The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Diagram of the Current System 3. Stimulant – Schistosoma 4.Display of Peptide 5.Signalling pathway 6.Output amplifying module

Chassis related problems E. coliB. subtilis Protein presentation + outer membrane + pilli +/- → Ben Protein detection -No membrane permeabillity +/- EnvZ modularity + ComE → Harriet - Not well characterised

Fast Response Module (FRM) – original plan

FRM – phosphorylation Multiple unknowns: Phosphorylation equilibrium Transient interaction Location of dimerisation

FRM – split protein problems Steric factors – flexible linkers and coiled coils Strength of affinity for the halves of TEV Loss of protease speed

The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Diagram of the Current System 3. Stimulant – Schistosoma 4.Display of Peptide 5.Signalling pathway 6.Output amplifying module 7.Parts from registry

The Baccellarator

The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Current Diagram of the System 3. Stimulant – Schistosoma 4.Display of Peptide 5.Signalling pathway 6.Output amplifying module 7.Parts from registry

Parasite detection Infective stages often water-bourne Use of proteases for skin penetration Detection via: -specific proteolytic cleavage of signaling molecules from surface of our organism and -consequent signal activation Major health care problem in many rural areas

Schistosoma Infective stage: water-bourne cecaria Releases proteases in the presence of unsaturated C18 fatty acids: – Oleic acid – Linoleic acid – Linolenic acid Chemotaxis and activation of invasive behaviour tested in lab and field

Proteases Mostly Elastase Well characterized and highly specific Expressed by three schistosoma speices only: – S. mansoni, – S. haematobium – S. douthitti SWPL sequence is cleaved most efficiently

Hookworm Nearly one billion people infected worldwide Larval stage exist in sandy or loamy soil Infection acquired when larval stage penetrates through skin skin penetration is associated with the secretion of an array of bioactive molecules including proteases, immunomodulators and proteins

The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Current Diagram of the System 3. Stimulant – Schistosoma 4.Display of Peptide 5.Signalling pathway 6.Output amplifying module 7.Parts from registry

Autoinducing Peptide Secretion and Surface Display

Exported Protein Structure AIP Cleavage Site Wall Binding NC

Secretion Mechanisms 4 varieties N-terminus Signal Peptide Removed during post-translocational modification Sec and Tat are the main mechanisms Must be in cell wall

Quality Control System Enzymes present in Periplasm Embedded in both the membrane and wall Screen all proteins that are abnormal, or have folded or bound incorrectly Hindrance to heterologous protein production Tat pathway may bypass some of this Further research needed

Cell Wall Binding Repeats Based at C terminus Repeated sequence Affinity for components of the cell wall Ionic attachment

Cell Wall Sorting Signal Based at C terminus LPxTG sequence + specialised tail Sortase SrtA binds protein to cell wall Covalent attachment Present in S. Aureus Similar mechanism possible in B. Subtilis

Potential Solutions Secrete into the extracellular space Doesn't carry as much risk Far less efficient/sensitive Develop synthetic surface protein Cell wall binding repeats + AIP Cell wall sorting signal Attach to existing surface protein 7 candidates at present All exported via Tat pathway

The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Current Diagram of the System 3. Stimulant – Schistosoma 4.Display of Peptide 5.Signalling pathway 6.Output amplifying module 7.Parts from registry

The Baccelerator Overview of presentation: 1.Fast Response Module - > change of plans 2.Current Diagram of the System 3. Stimulant – Schistosoma 4.Display of Peptide 5.Signalling pathway 6.Output amplifying module 7.Parts from registry

TEV Split GFP TEV recognition site GFP

Speed

Kinetics of amplification? Factors influencing the extent of amplification TEV transcription rate TEV rate of cleaving Dimerised TEV just 40% efficient! GFP and coiled coils being cleaved by both: -TEV 100% -TEV 40%