Automation, robotics, brains, and a new theory of Physics Sergio Pissanetzky 1.

Slides:



Advertisements
Similar presentations
Approaches, Tools, and Applications Islam A. El-Shaarawy Shoubra Faculty of Eng.
Advertisements

Statistical Mechanics and Evolutionary Theory
Emergent Inference and the Future of NASA Sergio Pissanetzky
Fuzzy immune PID neural network control method based on boiler steam pressure system Third pacific-asia conference on circuits,communications and system,
Central question for the sciences of complexity. How do large networks with.
Class Discussion Chapter 2 Neural Networks. Top Down vs Bottom Up What are the differences between the approaches to AI in chapter one and chapter two?
GOAL: UNDERSTAND CAUSAL AND INFLUENCE NETWORKS IN COMPLEX ADAPTIVE SYSTEMS IN ORDER TO CONTROL THEM.
Dynamics of Learning & Distributed Adaptation PI: James P. Crutchfield, Santa Fe Institute Agent-Based Computing Grantee Meeting 3-5 October 2000 Dynamics.
AN INFORMATION-THEORETIC PRIMER ON COMPLEXITY, SELF-ORGANISATION & EMERGENCE Mikhail Prokopenko CSIRO Fabio Boschetti CSIRO Alex Ryan DSTO.
Dynamics of Learning & Distributed Adaptation PI: James P. Crutchfield, Santa Fe Institute Second PI Meeting, April 2001, SFe Dynamics of Learning:
Study of Life Themes & Concepts Umbrella Concepts Big Ideas and Recurring Principles.
Large-scale organization of metabolic networks Jeong et al. CS 466 Saurabh Sinha.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Artificial Intelligence: Definition “... the branch of computer science that is concerned with the automation of intelligent behavior.” (Luger, 2009) “The.
Economics Majors Rank In the Top 10 for Salaries After Graduation
Emergent Inference, or How can a program become a self-programming AGI system? Sergio Pissanetzky Self-programming Workshop AGI-11.
CS206Evolutionary Robotics Anatomy of an evolutionary robotics experiment: 1.Create a task environment. 2.Create the robot. 3.Create the robot’s brain,
Artificial Intelligence
Neuroscience at NSF Status and Prosepctives Rae Silver Senior Advisor OIA/OD November ENG Advisory Committee ProcMem Comm Disk ProcMem Comm Bus.
Academic excellence for business and the professions C-agents: a notion that allows extension of Multi-Agent Systems (MAS) to SoS Eduardo Alonso Systems.
© 2007 Pearson Addison-Wesley. All rights reserved 0-1 Spring(2007) Instructor: Qiong Cheng © 2007 Pearson Addison-Wesley. All rights reserved.
Future & Emerging Technologies in the Information Society Technologies programme of European Commission Future & Emerging Technologies in the Information.
Computational Organization Theory Aaron Drajpuch WPI, CS525M, Spring 2002 Introduction What is an Organization What is Computational Organization Theory.
A New Theory of Neocortex and Its Implications for Machine Intelligence TTI/Vanguard, All that Data February 9, 2005 Jeff Hawkins Director The Redwood.
The Unification of Symmetry and Conservation
AP Biology 2013 Study of Life Themes & Concepts Based on work by Foglia, Goldberg.
1 CS 2710, ISSP 2610 Foundations of Artificial Intelligence introduction.
Graph Evolution: A Computational Approach Olaf Sporns, Department of Psychological and Brain Sciences Indiana University, Bloomington, IN 47405
Artificial Intelligence: Introduction Department of Computer Science & Engineering Indian Institute of Technology Kharagpur.
Major Disciplines in Computer Science Ken Nguyen Department of Information Technology Clayton State University.
Neural Networks and Machine Learning Applications CSC 563 Prof. Mohamed Batouche Computer Science Department CCIS – King Saud University Riyadh, Saudi.
Causality, symmetry, brain, evolution, DNA, and a new theory of Physics Sergio Pissanetzky 1.
The Matrix Theory of Objects An Update Sergio Pissanetzky Model Universality Behavior Constraints Dynamics Cost Chaos Attractors.
The Past and Future of the Sciences of Complexity The end is nigh! Past and Future 1.
Introduction to Artificial Intelligence CS 438 Spring 2008.
Controlling “Emergelent” Systems Raffaello D’Andrea Cornell University.
By: Nelson Webster. Algorithm Engineers Algorithm engineers study the effectiveness and efficiency of procedures of solving problems on a computer.
Chapter 2. From Complex Networks to Intelligent Systems in Creating Brain-Like Intelligence, Olaf Sporns Course: Robots Learning from Humans Park, John.
ARTIFICIAL INTELLIGENCE include people, procedures, hardware, software, data and knowledge needed to develop computer systems and machines that demonstrated.
MCC BP Based on work by K. Foglia Study of Life Themes & Concepts.
CS382 Introduction to Artificial Intelligence Lecture 1: The Foundations of AI and Intelligent Agents 24 January 2012 Instructor: Kostas Bekris Computer.
Information complexity - Presented to HCI group. School of Computer Science. University of Oklahoma.
Chapter 1. Introduction in Creating Brain-like intelligence, Sendhoff et al. Course: Robots Learning from Humans Bae, Eun-bit Otology Laboratory Seoul.
MODELS PURPOSE: Predict the future, test outcomes of various scenarios, identify the important components or variables, and understand how the parts interact.
The Theory of Objects and the automatic generation of Intelligent Agents Sergio Pissanetzky 2009.
Netlogo demo. Complexity and Networks Melanie Mitchell Portland State University and Santa Fe Institute.
Garry Jacobs CEO, World Academy of Art & Science Chairman of the Board & CEO, World University Consortium Vice-President, The Mother's Service Society.
Maestro AI Vision and Design Overview Definitions Maestro: A naïve Sensorimotor Engine prototype. Sensorimotor Engine: Combining sensory and motor functions.
HIERARCHICAL TEMPORAL MEMORY WHY CANT COMPUTERS BE MORE LIKE THE BRAIN?
Sub-fields of computer science. Sub-fields of computer science.
Electrical Engineering
第 1 章 绪论.
INFORMATION COMPRESSION, MULTIPLE ALIGNMENT, AND INTELLIGENCE
Artificial Intelligence ppt
What is Pattern Recognition?
Course Instructor: knza ch
Joelle Pineau: General info
Adaptive Systems and Analyst-independent technologies
Science Fair Categories
Software Engineering Experimentation
Dynamics of Learning & Distributed Adaptation James P
Phie Ambo, Mechanical Love,
Determinism is the philosophical belief that every event or action is
Dr. Unnikrishnan P.C. Professor, EEE
Principles of Computing – UFCFA3-30-1
CHAPTER I. of EVOLUTIONARY ROBOTICS Stefano Nolfi and Dario Floreano
Introduction to Artificial Intelligence Instructor: Dr. Eduardo Urbina
Structural Emergence in Partially Ordered Sets
Software Engineering Experimentation
Presentation transcript:

Automation, robotics, brains, and a new theory of Physics Sergio Pissanetzky 1

Complex systems with a detailed dynamics Too detailed for Statistical Mechanics or non-linear Dynamics. Examples: -- adaptive systems: brain, organisms, organs, species. -- robots, computers. 2

mother! ? adaptive system mother! 3

scale-free hierarchical network 4

mother 5 mother!

Central Theorem Any dynamical system has a scale-free hierarchical network of group-theoretical block systems that represents an invariant behavior of the system. 6

Fundamental principles of Physics causality, symmetry, least-action, energy/entropy BOTTOM - UP Theory of Causal Dynamical Systems complex systems with detailed dynamics, such as adaptive systems Causal set model – mathematical properties Action functional Scale-free hierarchical networks of information uncertainty, prediction, entropy, granularity //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// prediction 7

Fundamental principles of Physics causality, symmetry, least-action, energy/entropy TOP – DOWN BOTTOM - UP Theory of Causal Dynamical Systems complex systems with detailed dynamics, such as adaptive systems Causal set model – mathematical properties Action functional Scale-free hierarchical networks of information uncertainty, prediction, entropy, granularity //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// ///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// observation heuristic theory Neuro- science Bio- physics Evolution Artificial intelligence Computer engineering Physics Fuster Cuntz Friston Lin Eagleman Still (motor – proteins) Lerner Kauffman DNA Hawkins George (Numenta) Natural languages Google patents OO A&D Shih Tsallis Pernu-Annila Scale-free hierarchical networks of information uncertainty, prediction, entropy, granularity MOVEMENT? verification prediction 8