Changes to Syllabus: Quizzes put back: Change Oct. 3 to Oct. 17 Change Nov. 7 to Nov. 14 FastPlant lab delayed: Oct. 4 and 5.

Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite 3. prolific reproduction 4. transparent 5. only ~1000 cells 6. laser ablation 7. complete cell lineage map 8. genetics

Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite 3. prolific reproduction 4. transparent 5. only ~1000 cells 6. laser ablation 7. complete cell lineage map 8. genetics

RNA interference: A type of gene regulation Involving small RNA molecules and induced by double stranded RNA

Adding a Chalcone synthase gene from Petunia fused to a strong viral promoter to transgenic Petunia interfered with expression of the native homologous’ gene. Gene Silencing

Gene Silencing More common from strong promoters. 2. More common from inverted repeat inserts (could make a double stranded RNA). 3. Induced by RNA viruses (have double stranded RNA replication intermediates).

RNA viruses can block expression of a transgene if a copy of the transgene has been added Tobacco plant expressing GFP protein Infected with RNA virus with GFP gene Virus infection travels through veins GFP expression inhibited starting at veins.

Gene silencing and RNA viruses share potential to produce dsRNA Fire and Mello used C. elegans to prove that dsRNA inhibits expression of endogenous genes homologous to that dsRNA

Double stranded GFP RNA interferes with expression of GFP in transgenic C. elegans GFP expressed in nuclei After adding dsRNA for GFP

Double stranded GFP RNA interferes with expression of GFP in transgenic C. elegans GFP expressed in nuclei After adding dsRNA for GFP How would you design a genetic screen to identify the genes involved in the RNAi mechanism?

Features of RNAi Induced by dsRNA with homology to exons Catalytic: very small amounts of ds RNA are sufficient Spreads: injection into gut silences genes in embryos Small RNAs produced

The real genetic screen for C. elegans genes essential for RNAi

Mechanism of RNAi Dicer binds dsRNA And cleaves making siRNA siRNAs direct Risc to copy homologous mRNA Dicer binds short stretch of dsRNA and cleaves it.

Catalysis: RdRP copies mRNA making more ds RNA. Dicer cuts that generating more siRNA More RdRP is activated and more dsRNA is made. Spread: dsRNA transported to other cells. Not in Drosophila or mammals

What is the function of RNAi mechanism in non-transgenic organisms? Protection against viruses Keep Transposable elements inactive Gene regulation

Gene regulation by small RNAs SiRNAs degrade mRNA to stop gene expression quickly StRNAs prevent translation to stop gene expression quickly

miRNA Precursor Transcript MIRNA genes are PolII genes that encode a hairpin shaped mRNA. Dicer cleaves the double stranded portion to make a short dsRNA. That combines with the RISC complex and directs cleavage of a specific target mRNA MIRNA gene Pol II AAA DCL1 HYL1 ~100 MIRNA genes** DCL1 HEN1, HYL1 57 unique miRNAs from 26 families HASTY RISC components AGO1 miRNA Precursor Transcript miRNA* AGO1 RISCmiRNA Target ..... ............. AAA AGO1 **Cumulative data from Bartels, Carrington, Chen, Weigel, Zhu, others Cleaved target AAA

miRNAs and Targets in Animals Fig. 3 from Lewis, Burge and Bartel (2005) Cell 120, 15-20 May target 1/3 of all genes Registered miRNAs C. elegans 114 Drosophila 78 Zebrafish 362 Mouse 245 Human 321 Herpesviruses SV40 Development - e.g. timing, stem cell function, differentiation Cell and organ identity Cancer - mis-regulation, deletion, duplication of MIRNA genes

Transcriptional gene silencing is initiated by RNA directed methylation of promoter regions dsRNA homologous to promoters leads to methylation and inactivation by recruitment of chromatin remodeling enzymes.

Imprinting is another form of epigenetic gene regulation ICR – imprinting Control region Differential methylation leads to differential expression of Maternal and paternal alleles

RNA is a gene regulator as well as a carrier of information

microRNA Targets in Plants and Animals Plant miRNA Targets Animal miRNA Targets Single sites miRNA:target high complementary Usually in coding region Multiple sites, combinatorial miRNA:target low complementary 3’ UTR region ARF10 mRNA lin-14 mRNA 3’UTR AAA - - - - - - - - AAA UUGCAC-UCUCAGGGA |::||| ||||||||| 3’ AGUGUG AGAGUCCCU A C U 5’ C C CU AGGAAUACAGGGAGCCAGGCA || ||||||||||||||||| 3' ACCGUAUGUCCCUCGGUCCGU 5 miR160 lin-4 miRNA

Antiviral RNAi - Redundancy of DCL, RDR Factors v-siRNA duplex AGO v-siRNA* AGO RISCv-siRNA

Trans-acting siRNA gene MIRNA gene Trans-acting siRNA gene Pol II Pol II Poethig, Vaucheret/ D. Bartel labs AAA DCL1 HYL1 RDR6, SGS3 DCL1 HEN1, HYL1 DCL4 HEN1 HASTY RISC components AGO1 RISC components AGO miRNA* ta-siRNA* AGO1 RISCmiRNA AGO RISCta-siRNA Target Target ..... ............. AAA ..... ............. AAA AGO1 AGO Cleaved target Cleaved target AAA AAA Vazquez et al. (2004) Mol. Cell 16, 69-79; Peragine et al. (2004) Genes Dev. 18, 2368-2379

Trans-acting siRNA gene MIR gene Trans-acting siRNA gene Pol II Pol II AAA DCL1 HYL1 RDR6, SGS3 DCL1 HEN1, HYL1 DCL4 HEN1 HASTY RISC components AGO1 RISC components AGO miRNA* ta-siRNA* AGO1 RISCmiRNA AGO RISCta-siRNA Target Target ..... ............. AAA ..... ............. AAA AGO1 AGO Cleaved target Cleaved target AAA AAA