Nucleic Acids Genetic Material

Nucleic Acids are macromolecules There are two main types: DNARNA

A Nucleotide is the building block It is made up of three parts One part is a 5-carbon sugar One part is a 5-carbon sugar This sugar is also called ribose (in RNA) Or Deoxy-ribose (In DNA) – Deoxyribose nucleic acid

What is the difference between Ribose and Deoxy ribose?

Second part of a Nucleotide Nitrogen containing base There are four different bases: Adenine, Cytosine, Guanine, Thymine

3 D

The Third Component of a Nucleotide is a Phosphate Group

Put it all together now…

DNA is supercoiled Think of a Twisted Ladder

In HUMANs and most animals, DNA is always double stranded RNA is always Single stranded There are three kinds of RNA…which we will talk about later. There are three kinds of RNA…which we will talk about later.

The Double Helix In 1953 James Watson and Francis Crick proposed a model for DNA that is still accepted today

Two Experiments This is an x ray of crystallized DNA taken by Rosalind Franklin - The Dark Lady of DNA

Rosalind the Crystallographer

It was Rosalind’s image that led Watson and Crick to the double helix model of DNA DNA is made up of two long chains. Each with a sugar phosphate backbone BUT: The two back-bone’s run in opposite direction!

Watson and Crick determined that the four bases pair up very specifically Discovered in 1953, won Nobel Prize in 1962

Watson and Crick used discoveries of other researchers to build their model Experiments done by Rosalind Franklin and Maurice Wilkins suggested to Watson and Crick, that DNA molecules had a double helix structure

Watson and Crick came up with the idea of Base Pairing Cytosine only pairs with Guanine and vice versa Cytosine only pairs with Guanine and vice versa Thymine only pairs with Adenine and vice versa Thymine only pairs with Adenine and vice versa

The Genetic Code DNA forms the genes – units of genetic information that pass from parent to offspring The human genome is ~ 3 billion base pairs long and has been completely mapped

DNA taken with a Scanning Tunneling Microscope

A single DNA molecule - this is a chromosome

Unravelled vs condensed

DNA use as evidence Like a fingerprint DNA is unique to an individual Look your right or left The person sitting next to you is 99.9% similar to you

How can Forensic Scientists use DNA? In the human genome there are certain places where there are known sequences We can use these parts as markers and we can use specific enzymes to cut the DNA strand at this spot

Restriction Enzymes are used to cut DNA These enzymes are produced by certain types of viruses What these enzymes do is recognize specific patterns in a DNA sequence and cut the DNA like a pair of scissors

Viruses are an enemy of bacteria and people, and they can infect us by cutting our DNA, and inserting THEIR DNA!! Once their DNA is in we become Virus factories They have hijacked our cells, and they force us to produce more of them…this leads to us being sick and spreading them.

Restriction Enzymes Cut DNA at a palindrome What is a palindrome ? A sequence that reads the same backwards as forwards…Do you see the palindrome in the below sequence? GTAGAATTCATTCACGCACATCTTTAAGTAATGCGT

Now do you see it? GTA G-AATTC ATTCACGCA CAT CTTTAA-G TAATGCGT This is the region where a restriction enzyme would recognize and CUT or CLEAVE the DNA The actual name of this enzyme is Eco RI

Restriction Fragment Length Polymorphism This is the ability to cut DNA at a specific code using Restriction Enzymes These regions that scientists can cut, will result in varying segment lengths for different people, The Digested DNA will then be run using Gel Electrophoresis… This is how we can visualize the different DNA segment lengths

A molecule of DNA has an extremely negative charge So we can use this to run an electric charge through an electophoresis cell--- see below

As the electrical charge occurs we have a current of positive ions flowing through our gel. The DNA will migrate down the gel toward the positive end of the cell

The negative DNA is attracted to the Positive end of the electrophoresis cell

Do you see the different band patterns? They are all different size DNA pieces

After the DNA has been chopped up by enzymes, the shorter pieces will move down the gel faster than the longer pieces

Is it possible that two different people would have the same lengths strands after the DNA samples have been cut? Yes!!! - So this method would be a good way to eliminate suspects. This method alone could not incriminate a suspect

In a criminal case where DNA evidence is available an electrophoresis would be one of the first techniques used In actuality Forensic scientists don’t use electroporesis anymore…but it was one of the original DNA fingerprinting techniques Why do you think this is?

Because we the process is relatively inexpensive and quick to do, and suspects whose bands were very different could be immediately eliminated

Suspects who had similar banding patterns would have to be further analyzed …Their DNA would probably be sequenced to determine if the sequences matched

DNA can be sequenced using PCR The Polymerase Chain Reaction