Biotechnology Introduction Gel Electrophoresis

Method of analyzing DNA Allows a researcher to determine how alike or different two samples of DNA are.

Gel Electrophoresis Equipment 1.Gel 2.Gel box 3.Well and “lane” 4.Power supply 5.Liquid buffer solution 6.Restriction enzyme 7.DNA sample

1. The “gel” Made from agarose (like gelatin). Poured into a thin, flat square to harden. A comb-like object is left in one end to create “wells.” Agarose is porous when it cures. A current is forced through the gel from one side to the other. Lengths of DNA will travel with the current. The DNA will have to “work its way around” the pores in the gel. Shorter lengths of DNA will travel around the pores faster than longer ones.

Top View of a Gel Wells (DNA sample will be placed in here) Lanes (not actually visible & only three are labeled) DNA sample will “run” in this direction

Side view of a gel Well Arrow shows the direction DNA will “run” in

Microscopic view of a gel pore agarose Fragment of DNA “running” through gel

2. Gel box Plastic box that holds –Gel –Buffer solution –Electrodes to carry current through gel

Top view of gel box Electrodes Black = neg Red = pos These plug into the power source & create the electrical current Gel Direction of current

Side view of a gel box Electrode Well Gel Buffer solution Helps carry the current Plastic block gel sits on Direction of current Direction DNA “runs”

3. Wells 1.Small holes in the gel that the DNA samples will be placed in. 2.Created by placing a comb in the gel as it cures.

4. Lanes 1.Area below each well that the DNA sample will “run” through. 2.DNA always will stay in its lane and run with the current. 3.How far the DNA runs depends on how long it is. 4.Each lane will have “bands” of DNA when you are done “running” the gel.

Top view of DNA banding in lanes DNA “bands” (MANY pieces of DNA from a sample that are all the same length. Bands from different samples that “line up” show DNA that is similar.

5. Power supply 1.Electrical power that plugs into the gel box. 2.Provides a current that will flow across the gel. 3.Current will move DNA samples from the wells and down through the lanes.

6. Liquid buffer 1.Mostly water with some chemicals added. 2.Allows the current to travel through the gel better. 3.“Just” covers the gel in the box.

7. Restriction Enzymes 1.Enzymes that recognize certain base sequences in the DNA. 2.The enzyme will attach itself to the DNA at that sequence. 3.The enzyme will cut the DNA somewhere along the sequence

Restriction Enzyme Illustration A restriction enzyme may recognize the following base sequence in a DNA sample: –GGCTGG The restriction enzyme will bind to the DNA every time it “sees” that sequence of bases. It will cut the DNA between the C and the T Therefore the DNA will be cut into many smaller fragments. There are many different restriction enzymes & each recognizes a different base sequence.

Restriction Enzyme Illustration TAGCAGGCTGGTATTATGGCTGGTGCA Two restriction enzymes would bind to the bold segments Each restriction enzyme would cut the DNA between the C and T

The DNA would now be in three fragments… TAGCAGGC TGGTATTATGGC TGGTGCA If this sample was run through a gel, the bottom fragment would travel the farthest, the top fragment the second farthest, and the middle fragment the least farthest.