NASC Normalisation and Analysis of the Affymetrix Data David J Craigon

NASC What I am not going to talk about General microarray topics Biology

NASC The introduction

NASC Affymetrix workflow Biological sample of some sort AmplifyExtract mRNALabel and Fragment Hybridise to a chipScan chipFind features in scan Analyse down to one number per gene

NASC What do we want to find out? We want to find out how much mRNA of each type was in the original sample

NASC Biological sample of some sort AmplifyExtract mRNALabel and Fragment Hybridise to a chipScan chipFind features in scan Analyse down to one number per gene Each of these steps need to be proportional

NASC Biological sample of some sort AmplifyExtract mRNALabel and Fragment Hybridise to a chipScan chipFind features in scan Analyse down to one number per gene This talk is about this bit

NASC Affymetrix Chips On an Affymetrix chip each oligo takes up a square The RNA extracted from the plant is first amplified. Then is labelled. This allows the scanner to see it. The RNA is then hybridised to the array. Matching RNA for that square sticks to the square, and can be seen by the scanner. By observing the intensity of a square, the amount of RNA bound to that oligo can be calculated

NASC Design of the oligos Series of oligos designed for one gene Each oligo comes in two versions… 53

NASC Match and mismatch The exact match is a section of the mRNA sequence you wish to probe for The mismatch is identical except for one base difference from its exact match counterpart, and is used to calculate a background. There are typically 11 probe pairs scattered around the chip- called a probe set. By combining the expression values for a probe set, a value for the expression of mRNA can be found.

NASC EXP, DAT, CEL, CHP files EXP file- experiment file DAT file- the picture- like a TIFF. CEL file- a unnormalised number for each probe. CHP file- one number for each probeset

NASC What do you think of it so far? So far… What we want to find out is the amount of each mRNA in the starting sample. The mRNA hybridises to a series of probes. We can get a number for each probe from the CEL file.

NASC The rest of this talk We are going to go through four distinct ways of determining Signal values from CEL file data MAS 4 MAS 5 MBEI (dChip) RMA

NASC Mismatch probes in detail

NASC All about mismatch probes ATGCTGTACAATCGCTTGATACTGG ATGCTGTACAATAGCTTGATACTGG Mismatch probe: Target sequence: Perfect match probe:

NASC Why do we have mismatch probes? Mismatch probes (MM) are trying to detect background. The mismatch probes are supposed to detect things that are close but not an exact match. It is assumed that these things also bind to the perfect match (PM), erroneously.

NASC Yes folks, its Expression Method No 1! The original method that was used by MAS 4

NASC MAS 4 Algorithm For a probe set: A is the set of probes you havent thrown away due to being outliers j=0 to the number of probesets In English, the formula is very simple- throw away the outliers, then simply average the differences between PM and MM of the probes youve got left.

NASC Problems with the MAS4 algorithm Better fit with log(PM) preferred

NASC Expression Method No 2! MAS 5 method. Still used by GCOS- the current Affymetrix supplied method.

NASC Normalisation Procedure Before any work is done with the CEL data, the CEL file is normalised. Corrects for intra-chip differences

NASC Normalisation Procedure Divides the chip into K zones (by default, 16 zones) Select the lowest 2% of probes (of any description) Assume these are switched off

NASC Normalisation Procedure Calculate Mean, SD of these switched off probes for each section. Used as background. Each points local background weighted difference between each zone Subtract background from each probe.

NASC MAS 5 Algorithm For a probe set: Tukeys Biweight is an average that minimises the effect of outliers. IM is the ideal mismatch. This is the same as the MM intensity, except in the case where the MM is greater than the PM, in which case a new MM values is calculated based on other probes nearby

NASC

MAS4 to MAS5 comparison

NASC Signal Normalisation To try to eliminate chip-to-chip variability. Sort the signal values and remove the top and bottom 2% Calculate a scaling factor to adjust this middle 96%s mean to 100 (configurable, and variable) Multiply all signal values by the scaling factor Affymetrix state that scaling factors should be similar for arrays to be comparable

NASC Expression Method No 3! The MBEI method of Li and Wong. Found in dChip, so often known as the dChip method.

NASC Observation

NASC Observation The probes are vastly variable in effectiveness Li and Wong point out that the difference between probes is much greater than the difference between arrays! They contend that any proper model should take this into account.

NASC MBEI model

NASC MBEI model Baseline response due to noise Expression value (the thing we are interested in) Rate of increase of PM probe as signal increases (separate for each probe) Rate of increase of MM probe as signal increases (really? See later) Error term

NASC Model is fitted over all chips Processes an entire experiment at once Model is fitted using residual sum of squares In their paper on the subject they talk a lot about how you can use this model to detect outliers, scratches on the array, etc. Im not going to talk about that.

NASC RMA paper observations

NASC A spiked in experiment from the RMA paper It would be useful if we had an experiment where we knew the answer Run a series of experiments with a fixed background, but spike in some artificial RNA for a series of probes, at different concentrations.

NASC Mismatch probes Mismatch probes are supposed to calculate what similar things hybridise to probes, to detect background for PM probes. The background should be at a relatively low level most of the time…

NASC Yikes! Actually MM>PM between 33% and 40% of the time!

NASC Mismatch probes Mismatch probes are supposed to calculate what similar things hybridise to probes, to detect background for PM probes. The amount of this stuff shouldnt depend on how much interesting RNA there is about…

NASC Man the lifeboats!

NASC Some observations from the RMA paper … perfect match probes appear to be additive (in the log scale)

NASC The amount of signal does affect mismatch probes. Clearly some of the useful mRNA is hybidising to the MM probes. This kind of shock has led to some people abandoning the use of MM probes altogether!

NASC Whats going on?

NASC Perfect match probes … in RMA, in the log scale, they assume that probe effects are effectively additive

NASC How RMA (roughly) works

NASC RMA process Normalise array Fit model

NASC Normalisation procedure involves adusting distributions

NASC RMA process Normalise array Fit model

NASC Fit model Correct background using estimate from all mismatch probes for each array. Fit model: Log scale expression value Additive probe affinitive effect for this probe over all slides Background corrected PM value

NASC In summary then… There are various ways you can get from a CEL file to expression estimates. These models are derived by considering the behaviour of PM and MM probes Both dChip and RMA show better results than the standard Affy algorithm MM probes in particular behave contrary to how you would expect.

NASC Enough theory- how do you actually do these things? The MAS5 algorithm can be performed using (erm) MAS5! dChip is a piece of software that will be making an appearance later this afternoon, and can do the MBEI algorithm The RMA authors have a piece of software called RMAExpress, which does RMA for Windows. All of these algorithms can be done using the Bioconductor package in R.

NASC