Section 2 DNA Replication in Eukaryotes

Biomolecules involved in DNA replication  Substrate: dNTPs (dATP, dGTP, dCTP, dTTP)  Template unwinding parent DNA double strands  Primer a short segment of RNA with 3’-OH for adding dNTPs by polymerases.  Others: many enzymes and protein factors

1. Eukaryotic Enzymes and Associated Protein Factors involved in DNA Replication DNA dependent DNA polymerase Primase Helicase Replication protein A (Single strand DNA binding protein) Topoisomerase Proliferating cell nuclear antigen (PCNA) Replication factor C RNase H and Flap endonuclease 1 DNA ligase

(1) DNA polymerase (dNMP) n + dNTP (dNMP) n +1 + PP i DNA polymerase ① the basic chemical reaction  The polymeration direction: 5’  3’.  DNA polymerase needs primer (a segment of oligonucleotide to provide free 3’-OH, to which nucleotide is able to add one by one.

end

② the classification and functions of Eukaryotic DNA polymerase DNA polymerase      Molecular weight >250  10 3 (36-38)  10 3 ( )    10 3 Location in cells nucleus mitochodrion nucleus 5’  3’ polymerase activity middle exist high 3’  5’exonuc- lease activity no exist primase exist no Major functionPrimase activity, initiate replication, partly synthesize lagging strand Involve in repair of DNA damage with low degree of fidelity DNA replication in Mt The major enzyme in DNA replication (elongate daughter strands and helicase activity) filling Gap left from primer removing, excision repair, and recombinati on.

（ 2 ） primase DNA polymerase is unable to connect two deoxy- ribonucleotides together, the primer is required to provide 3’- OH for adding the nucleotide one by one. 1.Primase combines with DNA-polαto form a complex. 2.Primase can synthesize a RNA primer (ATP, CTP, UTP, GTP as substrates ）, an oligo-nucleotide with 10 nucleotides long. 3.Based on the primer, an oligodeoxyribonucleotide with 15~30 nucleotides long can be synthesized by DNA-polα for further elongation. Primer (10nt) DNA segment (15  30nt)

（ 3 ） Helicase To separate parental DNA double helix into two single strands, and move along the single stranded DNA to make DNA synthesis easier. Replication fork end

（ 4 ） Single-strand DNA binding protein, SSB SSB combines with single stranded DNA to stabilize the single strand in the replication region, and prevents the single strands rewind to form double helix again. In eukaryotic cells, the SSB is called replication protein A, RPA. helicase SSB (RPA)

(5) Topoisomerase Topoisomerase has both endonuclease and DNA ligase activities, it can hydrolyze and ligate the DNA phosphodiester bond. The function is to change the conformation of DNA molecule and relieve the torsional stress of positive supertwisting state.

Normal helix Supertwisted with torsional stress The best way to relieve the stress is to cut one or two strands, and then link together

The types of topoisomerase ： ① Type I topoisomerase ： cuts off one strand of the DNA double helix (endonuclease activity) ， and then links the two end together ( DNA ligase activity) ， this process need not ATP. This enzyme is the major enzyme and involves in replication and transcription. ② Type II topoisomerase: cut off DNA double strands, and then links together. This process needs ATP, and involves in replication.

（ 6 ） Proliferating cell nuclear antigen, PCNA PCNA is the adapter protein of DNA polymerase . The 3 subunits of PCNA are assembled to form a ring around DNA, to which DNA polymerase  attaches. So the PCNA is a sliding clamp to carry polymerase  to slide along the template.  DNA The trimer of PCNA

(7) Replication factor C, RFC RFC is a clamp-loading protein, helping PCNA ring to assemble to the DNA template. RFC as a adapter attaches both DNA polymerase α and  ， and help the synthesis of leading strand and lagging strand simultaneously. 

(8) RNaseH and flap endonuclease 1 (FEN1) These enzymes catalyze the hydrolysis of primer. RNaseH degrades the RNA primer and leaves the last ribonucleotide for FEN1 to hydrolyze.

（ 9 ） DNA ligase DNA ligase catalyzes the joining of the end of two DNA chains by forming 3’,5’-phosphodiester bond. nick

2. DNA replication in eukaryotic cells （ 1 ） The initiation of DNA replication ① Origin recognition Origin recognition complex (ORC) recognizes the origin sequence ( AT rich regions called autonomously replicating sequence, ARS, or replicator), and assembles on it. Then mini-chromosome maintenance protein, MCM (with helicase activity) binds to it to form replication fork and replication bubble. Then replication protein A and helicase assemble to the bubble too.

replicator A+T rich 起始辨认复合物 Origin recognition complex, ORC 小染色体维系蛋白 Mini-chromosome maintenance protein, MCM 复制蛋白 A Replication protein A, RPA RPA 解旋酶 Helicase 引物酶 -DNApolα Primase/DNA Pol  Replication fork 复制叉 end

② formation of primers The complex formed from DNA-pol  and primase assembles to the origin, and synthesizes a 10bp long RNA primer ， then DNA-pol  catalyzes the synthesis of a DNA segment with 15~30 deoxyribonucleotide. end primase pol  10bp15~30bp

While DNA replication, the direction of elongation is the same of that of replication fork movement. The leading strand is synthesized continuously in 5’  3’ direction. （ 2 ） Elongation of DNA chains Formation of DNA fragment; Hydrolysis of RNA primer; Formation of DNA molecule While DNA replication, the lagging strand is synthesized discontinuously in 5’→3’ direction, the opposite direction of replication fork movement to form many short segments named Okazaki fragments. Reiji Okazaki ( )

origin 5’ 3’ primase pol  primer RFC pol  RFC pol  RFC pol  RNase H FEN 1 ? ? After hydrolyzing the primers at 5’ end of the telomere, how the gaps are filled ? telomerase can solve the problem. End

The fidelity of DNA replication 1 、 The base pairing rule is extremely obeyed, A=T, G≡C 2 、 DNA polymerase accommodates only correct base pairs. 3 、 DNA polymerase has proofreading function (3’  5’ exonuclease activity) (In E. coli, a mistake is made only once for every 10 9 to nucleotides added. For the E.coli chromosome of ~4.6  10 6 bp, this means that an error occurs only once per 1000 to replications. ) ATGGTCGGATTACGTAAGTCTAC TACCAGCCTAATG 3’ 5’ A ATTCAGATG 5’ 3’ 3’  5’ exonuclease activity has very high proofreading function, can recognize the mismatch base and hydrolyze it. end

(3) DNA synthesis in telomere —Replication of the ends of linear DNA 5’ ? ? Hydrolysis, polymerization, ligation

Telomere Chromosomal DNA in eukaryotes is linear, telomeres are repetitive sequences that cap the ends of the chromosomes. 1. Structural properties 1) Telomeres consist of the repeat sequence TTAGGG repeated in tandem between 500 and 5000 times. 2) The telomeric repeats bind proteins to cap the chromosome. 2. Function To protect DNA from enzymatic attack and to help stabilize the chromosome. AATCCCAATCCCAATCCCAAT TTAGGGTTAGGGTTAGGGTTA

Telomerase 1. The structure of human telomerase 1) Human telomerase RNA (template of reverse transcriptase) 2) Human telomerase reverse transcriptase 3) Human telomerase-associated protein 1 2. Function Telomerase is responsible for telomere synthesis and thus for maintaining the length of the telomere. Telomerase can proceed telomere DNA synthesis by reverse transcription, and its own RNA serves as the template. TTAGGGTTAGGGTTAGGGTTA-3’ -5’

CCCCAACCCCAACCCC 5’

AACCCCAAC 3’ 5’ GGGTTG 5’ 3’ TG G G T G G G G T T G G G G T T GG G G T T G-3’ CCCAACCCCAACCCCAACCCCAACCCCAAC-5’

2/3 Lagging strand origin Leading strand origin 3/3 (4) Mitochondrial DNA replication——D-loop replication There are two origins. The leading strand synthesis precedes lagging strand synthesis. The leading strand displaces the lagging strand template to form a displacement or D loop. When is has reaches a point 2/3 of the way around the chromosome, the lagging strand origin is exposed and its synthesis proceeds in the opposite direction around the chromosome. Therefore, the synthesis of the two strands are both continuous.